ID: 993203390

View in Genome Browser
Species Human (GRCh38)
Location 5:84847510-84847532
Sequence GTTATCTGCAGAAGACAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993203390_993203395 26 Left 993203390 5:84847510-84847532 CCCTGCTGTCTTCTGCAGATAAC No data
Right 993203395 5:84847559-84847581 GACCTGTTACTAAGCTTTGGTGG No data
993203390_993203394 23 Left 993203390 5:84847510-84847532 CCCTGCTGTCTTCTGCAGATAAC No data
Right 993203394 5:84847556-84847578 CTTGACCTGTTACTAAGCTTTGG No data
993203390_993203392 -10 Left 993203390 5:84847510-84847532 CCCTGCTGTCTTCTGCAGATAAC No data
Right 993203392 5:84847523-84847545 TGCAGATAACTACTCTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993203390 Original CRISPR GTTATCTGCAGAAGACAGCA GGG (reversed) Intergenic
No off target data available for this crispr