ID: 993203391

View in Genome Browser
Species Human (GRCh38)
Location 5:84847511-84847533
Sequence AGTTATCTGCAGAAGACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993203391_993203394 22 Left 993203391 5:84847511-84847533 CCTGCTGTCTTCTGCAGATAACT No data
Right 993203394 5:84847556-84847578 CTTGACCTGTTACTAAGCTTTGG No data
993203391_993203395 25 Left 993203391 5:84847511-84847533 CCTGCTGTCTTCTGCAGATAACT No data
Right 993203395 5:84847559-84847581 GACCTGTTACTAAGCTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993203391 Original CRISPR AGTTATCTGCAGAAGACAGC AGG (reversed) Intergenic
No off target data available for this crispr