ID: 993203393

View in Genome Browser
Species Human (GRCh38)
Location 5:84847539-84847561
Sequence GTCAAGAGCTATTTATCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993203393_993203397 18 Left 993203393 5:84847539-84847561 CCTTTGGATAAATAGCTCTTGAC No data
Right 993203397 5:84847580-84847602 GGAAACTGAACATTTGACTATGG 0: 53
1: 132
2: 165
3: 111
4: 311
993203393_993203395 -3 Left 993203393 5:84847539-84847561 CCTTTGGATAAATAGCTCTTGAC No data
Right 993203395 5:84847559-84847581 GACCTGTTACTAAGCTTTGGTGG No data
993203393_993203398 19 Left 993203393 5:84847539-84847561 CCTTTGGATAAATAGCTCTTGAC No data
Right 993203398 5:84847581-84847603 GAAACTGAACATTTGACTATGGG 0: 60
1: 133
2: 160
3: 122
4: 259
993203393_993203394 -6 Left 993203393 5:84847539-84847561 CCTTTGGATAAATAGCTCTTGAC No data
Right 993203394 5:84847556-84847578 CTTGACCTGTTACTAAGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993203393 Original CRISPR GTCAAGAGCTATTTATCCAA AGG (reversed) Intergenic
No off target data available for this crispr