ID: 993203394

View in Genome Browser
Species Human (GRCh38)
Location 5:84847556-84847578
Sequence CTTGACCTGTTACTAAGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993203393_993203394 -6 Left 993203393 5:84847539-84847561 CCTTTGGATAAATAGCTCTTGAC No data
Right 993203394 5:84847556-84847578 CTTGACCTGTTACTAAGCTTTGG No data
993203391_993203394 22 Left 993203391 5:84847511-84847533 CCTGCTGTCTTCTGCAGATAACT No data
Right 993203394 5:84847556-84847578 CTTGACCTGTTACTAAGCTTTGG No data
993203390_993203394 23 Left 993203390 5:84847510-84847532 CCCTGCTGTCTTCTGCAGATAAC No data
Right 993203394 5:84847556-84847578 CTTGACCTGTTACTAAGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993203394 Original CRISPR CTTGACCTGTTACTAAGCTT TGG Intergenic
No off target data available for this crispr