ID: 993203397

View in Genome Browser
Species Human (GRCh38)
Location 5:84847580-84847602
Sequence GGAAACTGAACATTTGACTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 772
Summary {0: 53, 1: 132, 2: 165, 3: 111, 4: 311}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993203396_993203397 -4 Left 993203396 5:84847561-84847583 CCTGTTACTAAGCTTTGGTGGAA No data
Right 993203397 5:84847580-84847602 GGAAACTGAACATTTGACTATGG 0: 53
1: 132
2: 165
3: 111
4: 311
993203393_993203397 18 Left 993203393 5:84847539-84847561 CCTTTGGATAAATAGCTCTTGAC No data
Right 993203397 5:84847580-84847602 GGAAACTGAACATTTGACTATGG 0: 53
1: 132
2: 165
3: 111
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993203397 Original CRISPR GGAAACTGAACATTTGACTA TGG Intergenic
900434967 1:2625643-2625665 GGAAAGTGAACGTTTGACTACGG + Intronic
901904043 1:12392617-12392639 GGAAAATGAACATCTGACTATGG - Intronic
904179487 1:28655904-28655926 AGAAACTGAACGTTTGACTATGG - Intergenic
904335939 1:29798053-29798075 AGAAACTGAATGTTTGACTATGG + Intergenic
905465232 1:38148166-38148188 GGAAATTGAACGTTTGACTATGG + Intergenic
906050496 1:42867481-42867503 GGAAACTGAACATTTGACTATGG + Intergenic
906862258 1:49374148-49374170 GGAAACTACTCATTTGACTCAGG - Intronic
906879681 1:49576530-49576552 GGAAACTGAAAGTTTGACTATGG + Intronic
906908710 1:49923552-49923574 GCAAACTATGCATTTGACTAAGG + Intronic
906926561 1:50123922-50123944 GAAAAATAAACATTTGATTATGG - Intronic
906945869 1:50293629-50293651 GGAAAATGAAAATATGATTATGG + Intergenic
907030606 1:51167449-51167471 AGAAACTTAACATATGACCATGG - Intergenic
907597348 1:55732197-55732219 GGAAACTGAGCATTTGACTATGG + Intergenic
907780349 1:57560901-57560923 GGAAACTGAACGTTTGACTACGG + Intronic
908737395 1:67290880-67290902 CGAAACTGAACGTTTGACTATGG + Intergenic
909064325 1:70915975-70915997 GCAAACTGTACATCTAACTAAGG + Intronic
909172601 1:72315399-72315421 AGAAACTGAATGTTTGACTATGG - Intergenic
909210776 1:72819995-72820017 GCAAACTGCACATTTGACAAAGG + Intergenic
909234824 1:73139389-73139411 GCAATCTAAACATTTGACAAAGG - Intergenic
909278738 1:73722190-73722212 AGAAACTGAGCACTTGACTATGG + Intergenic
909548941 1:76877116-76877138 GGAAACTGATCATTTGGCTATGG - Intronic
909810962 1:79931404-79931426 GGAAGCTGAATATTTGGCTATGG + Intergenic
909899308 1:81112500-81112522 GGAAATAGAACATTTCATTAGGG - Intergenic
910370642 1:86512195-86512217 GGAAACTGAATATTTGACTATGG + Intergenic
910561906 1:88600048-88600070 GAAAACTGAACGTTTGACTATGG + Intergenic
910630230 1:89346319-89346341 GGAAACTGAACATTGGACTATGG + Intergenic
910638984 1:89439907-89439929 GGAAAATGAACCTTTGACTATGG - Intergenic
910790329 1:91043787-91043809 GGAAAATGAACCTTTGACTATGG + Intergenic
910831090 1:91463357-91463379 GGAAACTGAATGTTTGACTATGG - Intergenic
911109090 1:94164138-94164160 GGAAACTGAATATTTGACTATGG - Intronic
911257317 1:95647297-95647319 GGAAACTGAACATTTGACTATGG - Intergenic
911352457 1:96771038-96771060 AGAAAAAGAACATTTGACCAGGG - Intronic
911485809 1:98503651-98503673 GGAAAATAAGCATTTTACTACGG - Intergenic
911738390 1:101361852-101361874 GGAAACTGAACTTTTGACTACGG - Intergenic
911980433 1:104559488-104559510 GGAAACTGAATGTTTGACTGTGG + Intergenic
911981892 1:104579195-104579217 GGAAACTGAATGTTTGACTATGG - Intergenic
912050671 1:105524881-105524903 GGAAACTGAACGTGTGACTATGG - Intergenic
912067032 1:105757022-105757044 GGAAACTGAATGTTTGACTATGG + Intergenic
912129906 1:106587983-106588005 AGAAACTAAACGTTTGACTATGG - Intergenic
912172203 1:107114194-107114216 TGACACTGACCACTTGACTATGG - Intergenic
912212259 1:107568961-107568983 GGAAACTGAACATTTGACTATGG + Intergenic
912252022 1:108021321-108021343 GGAAACTGAACGTTTGACTGTGG - Intergenic
912671669 1:111634073-111634095 GGACACTGAACATGTGGTTATGG - Intronic
912733315 1:112128762-112128784 GGAAACTGAACATTTGATTATGG - Intergenic
913039439 1:115008328-115008350 GGAAACTGAACATTTGACTACGG - Intergenic
913333363 1:117685520-117685542 GGAAACTGATCTTGTGACTCTGG + Intergenic
913692468 1:121292428-121292450 GGCAACTGAAAATTTGACATTGG + Intronic
914145088 1:144987666-144987688 GGCAACTGAAAATTTGACATTGG - Intronic
915041032 1:152968440-152968462 GGAAACTGAAACTTTGAATGAGG - Intergenic
915667664 1:157459576-157459598 GGAAACTAAACATTTGACTATGG - Intergenic
916106322 1:161435260-161435282 GGAAACTGAACGTTTGAGTGTGG - Intergenic
916285324 1:163099595-163099617 GGAAACCGAACATTTGACTATGG + Intergenic
916369834 1:164079863-164079885 GGAAACTGAACAGTTAACCATGG + Intergenic
917217207 1:172690846-172690868 GGATACTGAACGTTTAGCTATGG - Intergenic
917805760 1:178612085-178612107 GAAAACTAAATATTTGAATAAGG + Intergenic
917945273 1:179963214-179963236 GCAAACTGTACATCTGACAAAGG - Intronic
918650890 1:186961841-186961863 GGAAACTGAAACCTTGAATAAGG - Intronic
918755705 1:188337742-188337764 GGAAACTGAATATTTGACTATGG - Intergenic
918774500 1:188610814-188610836 GGAAACACAATGTTTGACTACGG + Intergenic
918815085 1:189171295-189171317 GGAAACTGAATGTTTGACTGTGG + Intergenic
918918223 1:190671812-190671834 GGAAAATGAACGTTTGACTATGG - Intergenic
919124609 1:193379714-193379736 AGTAACTGAACGTTTGACTAAGG - Intergenic
919241779 1:194924271-194924293 GAAAACTGAACGTTTGACTATGG + Intergenic
919317978 1:195999429-195999451 AGAAACTAAATGTTTGACTATGG + Intergenic
919933674 1:202237346-202237368 GCAGACTAAACATTTGCCTAGGG + Intronic
920197438 1:204238433-204238455 GGAAACTGAACGTTTGACTATGG + Intronic
920479787 1:206310785-206310807 GGCAACTGAAAATTTGACATTGG + Intronic
921457788 1:215393211-215393233 GTAAACTGTACATCTGACAAGGG + Intergenic
921471605 1:215556924-215556946 GGCAACTGAACATTTTTCCAGGG - Intergenic
921602834 1:217124835-217124857 GGATACTCAACCTTTGGCTAGGG - Intronic
922781043 1:228252514-228252536 GGAAACTGAACAATTGACTATGG - Intronic
923253562 1:232199370-232199392 GGAAACTGAACGTTTGACTATGG - Intergenic
923636656 1:235704654-235704676 GCAAACTGTACATCTGACAAAGG - Intronic
924847126 1:247785070-247785092 TGAAACCAAAGATTTGACTATGG - Intergenic
1063039164 10:2318993-2319015 GGATACTGACAATTTAACTATGG + Intergenic
1063553261 10:7053394-7053416 GGAATGTGAACATTAGACTAAGG - Intergenic
1063589733 10:7384686-7384708 GTAAACTGAGCAATTTACTATGG + Intronic
1064517634 10:16168189-16168211 GGAAACTGAACATTTGACTATGG - Intergenic
1064545682 10:16448068-16448090 AGAAACTGAACGTTTAACTATGG - Intronic
1064752764 10:18548564-18548586 GCCAACTGAACATTTAAGTAGGG - Intronic
1064829712 10:19449074-19449096 GAAAACTGAACAATTTACTGAGG - Intronic
1065005333 10:21374231-21374253 GGAAACTGAACGTTTGATTATGG + Intergenic
1065518361 10:26547302-26547324 GCAAATTATACATTTGACTAAGG - Intronic
1066164062 10:32766617-32766639 AGAAACTGAACACTTAACCATGG + Intronic
1066167021 10:32799163-32799185 AGAAACTAAACATTTGACTATGG - Intronic
1066169434 10:32826385-32826407 AGAAACTGAACATTTGACTATGG + Intronic
1066205642 10:33186676-33186698 GCAAAATGGACATTTGATTAGGG + Intronic
1066220066 10:33328357-33328379 GGAAACTGATCATCAGCCTATGG + Intronic
1067016795 10:42762850-42762872 GCAAACTGTCCATTTGACAAGGG - Intergenic
1067125545 10:43512477-43512499 GGAAACTGAAGGTTTGACTATGG - Intergenic
1067333144 10:45340284-45340306 GGAAACTGAACATTTGATTATGG + Intergenic
1067754345 10:48993652-48993674 CGAAACTGAACGTTTGACTATGG - Intergenic
1068007666 10:51409503-51409525 GGAAACTAAATGTTAGACTATGG - Intronic
1068820503 10:61372223-61372245 GCAAACTATACATTTGACAAAGG - Intergenic
1068837209 10:61568311-61568333 GGAAACTGAACATTTGACTATGG - Intergenic
1068861479 10:61852267-61852289 GAAAACTGAAAATTTCATTATGG - Intergenic
1068883001 10:62069896-62069918 GGAAACTGAAAATTTCCCTCTGG + Intronic
1068994428 10:63186336-63186358 AGAAAATGAACATTAGCCTATGG - Exonic
1069192297 10:65506303-65506325 GCAAATTGAACGTTTGACTATGG - Intergenic
1069640544 10:69952683-69952705 GGAACCTGAGAATTTGGCTAAGG - Intronic
1069790822 10:71019516-71019538 GGAAACTGAACGTTTGACTATGG - Intergenic
1071039034 10:81284564-81284586 AGAAAGTGAAGTTTTGACTATGG - Intergenic
1071267077 10:83973935-83973957 GGAAACTGAACATTTGACTATGG - Intergenic
1071364464 10:84884454-84884476 AGAAACTGAACGTTCAACTATGG - Intergenic
1071378389 10:85033424-85033446 GGAAACTGAACGTTTGACTAGGG + Intergenic
1071937696 10:90549343-90549365 GGAAACTGAACATTTGACCATGG + Intergenic
1071942775 10:90607711-90607733 GGAAACTGAACATTTAACTATGG - Intergenic
1071947081 10:90657664-90657686 AGAAACTGAACACTTGACCATGG - Intergenic
1072360474 10:94654210-94654232 GGAAACTGAACGTTTGACTATGG + Intergenic
1072372424 10:94777883-94777905 GCAATCTGTCCATTTGACTAAGG + Intronic
1073170830 10:101506622-101506644 GGAATTTTAACATTTAACTATGG - Intronic
1073918469 10:108432248-108432270 GGAAACTGAATGTTTGACTATGG - Intergenic
1073995867 10:109314650-109314672 GGAAACTGAACATTTGACTATGG - Intergenic
1075606795 10:123817466-123817488 GTAAACTGAACATTTGTCTATGG + Intronic
1075880889 10:125849790-125849812 GGAAACTCAAGATTTGGCTTTGG - Intronic
1076586376 10:131550978-131551000 GGGGACTGAAAATTTGAATAGGG + Intergenic
1076772622 10:132674772-132674794 GGAAACTGAACGTTTGTCTATGG - Intronic
1077381085 11:2237970-2237992 AGAAACTGAATGTTTGACCATGG + Intergenic
1077396534 11:2326419-2326441 AGAAACTAAACACTTGACCAAGG + Intergenic
1077735455 11:4786049-4786071 GGAAACTGAACAAGTCTCTATGG + Intronic
1077812332 11:5650779-5650801 GGAGACTGAACACTGAACTATGG - Intergenic
1078349954 11:10584449-10584471 GGAAACTGCACATTAGGCCAAGG - Intronic
1080976685 11:37350639-37350661 GGAAACTGAACGTTTGACTATGG + Intergenic
1081065455 11:38534835-38534857 GGAAACTGAATGTCTGACTATGG - Intergenic
1081072783 11:38631162-38631184 GGAAACTGAACATTTGACCATGG + Intergenic
1081110482 11:39128460-39128482 AGAAACTGAACATTTGACCATGG + Intergenic
1081609067 11:44547919-44547941 GGAAACTGAAACTTTGACTATGG + Intergenic
1082119221 11:48359933-48359955 ATAAACTCAACATTTGACGAAGG + Intergenic
1082999666 11:59279920-59279942 GAAAACTGAACGTTTGACTGAGG + Intergenic
1083698040 11:64455692-64455714 AGAAACTGAGCATCTGACCAGGG + Intergenic
1085685968 11:78622231-78622253 GGAAACTGAACGTTTGATTATGG + Intergenic
1085747577 11:79128281-79128303 GGAAACTGAACATTTGACTATGG + Intronic
1086141629 11:83506143-83506165 GGAAACTGAACGTTTGACTACGG - Intronic
1086156746 11:83675602-83675624 AGAATCAGAACATTTGACTGTGG + Intronic
1086667641 11:89503187-89503209 TGCAACTGAAAATTTGGCTATGG - Intergenic
1086834122 11:91600434-91600456 GGAAACTGAACATTTGACTGTGG + Intergenic
1087310873 11:96541614-96541636 GCAAACTATACATTTGACAAGGG - Intergenic
1087374028 11:97320595-97320617 GGAAACTGAACATGTGAAAATGG + Intergenic
1088097210 11:106115199-106115221 AGAAACTGAACGTTTGACTATGG + Intergenic
1088191654 11:107234449-107234471 GGAAACTGAACATTTGACTATGG - Intergenic
1088265423 11:107983652-107983674 GGAAACTGAACATTTGACTATGG + Intergenic
1088407606 11:109498621-109498643 GGAAACTGAACGTTTGACTATGG - Intergenic
1088449361 11:109965409-109965431 GGAAACTGAATGTTTGACTACGG + Intergenic
1088836662 11:113583430-113583452 GGAAACTGAACATTTGACTGTGG + Intergenic
1089903612 11:122013650-122013672 GGAAACCGAATGCTTGACTATGG + Intergenic
1090753981 11:129772545-129772567 GGAGACTGAATGTTTGACCATGG - Intergenic
1091051744 11:132378797-132378819 GGAACCTGAACGTTTGACTATGG + Intergenic
1091103477 11:132897301-132897323 AGAAACTGAACGCTTGACCATGG + Intronic
1091289015 11:134426737-134426759 GGAAAATGAACATGTGCCCATGG - Intergenic
1092093288 12:5821692-5821714 GGAAACTGAACGTTTGACTATGG + Intronic
1092381565 12:8000980-8001002 GGAAACTGAACGTTTGACTATGG + Intergenic
1092486202 12:8904044-8904066 GGCAACTGTAAATCTGACTAAGG - Intergenic
1093031864 12:14295908-14295930 GGAAACAGAACGTTTGACTATGG - Intergenic
1093036343 12:14335725-14335747 GGAAACTGAATGTTTGATGATGG + Intergenic
1093048917 12:14484925-14484947 GGAAACTGAACATTTGACTATGG - Intronic
1093049663 12:14490920-14490942 GGAAACTGAACATTTGACTATGG - Intronic
1093964544 12:25310998-25311020 AGAAACTGAACGTCTGACTATGG + Intergenic
1094102536 12:26779304-26779326 GGAAACTGAACATTTAACTATGG + Intronic
1094389815 12:29936699-29936721 AGAAAATGAACATTCCACTAGGG - Intergenic
1094462969 12:30717900-30717922 GGAAACTTAACATTTTAGTATGG - Intronic
1095121500 12:38424802-38424824 GGAAACTGAATGTTTGAGTATGG - Intergenic
1095190269 12:39250206-39250228 GGAGACTGAACACTTAACCATGG + Intergenic
1095603860 12:44044376-44044398 GGAAACTGAACGTTTGACCATGG + Intronic
1095844387 12:46729926-46729948 GGAAATTGGACATTTGGCCATGG - Intergenic
1095856233 12:46863634-46863656 GGAAATTGAAAATTTGACTATGG - Intergenic
1096288718 12:50323002-50323024 GGAAACTGAACATTTGACTATGG + Intergenic
1096457460 12:51799395-51799417 GGAAACTGAACGTTTGACCATGG - Intronic
1097726209 12:63078418-63078440 GGAAACTGAATATCTGACTAAGG + Intergenic
1097821335 12:64131822-64131844 GGAAACTGAACGTTTGACCATGG - Intronic
1097843351 12:64342719-64342741 GGAAACTGAACGTTTGACCATGG - Intronic
1098673046 12:73254286-73254308 TGAAATTGAACATTTGACAATGG + Intergenic
1098716097 12:73829857-73829879 GGAAACTGAACATTTGACTATGG + Intergenic
1098731056 12:74037390-74037412 GAAAACTGAACATTTGACTATGG + Intergenic
1098733297 12:74065673-74065695 GGAAACTGAACGTTTGACTGTGG + Intergenic
1098749849 12:74279633-74279655 GGAAACTGAACATTTGATTATGG + Intergenic
1098805378 12:75015554-75015576 AGAAACTGAACGTTTGACTATGG + Intergenic
1098831901 12:75373983-75374005 AGAAACTGAACGTTTGACTGTGG - Intronic
1099183373 12:79492546-79492568 GGAAACTGAACATTTGACTATGG - Intergenic
1099365930 12:81765426-81765448 GGAAACTGAATGTTTGACTATGG + Intergenic
1099372586 12:81855131-81855153 GGAAACTGAACATTTCCATTTGG + Intergenic
1099375653 12:81893999-81894021 GGAAAGTGAATGTTTGACTATGG + Intergenic
1099379376 12:81936498-81936520 GGAAACTGAACATTTGATTATGG - Intergenic
1099458489 12:82894195-82894217 GGCAACTGAATAATTGCCTATGG + Intronic
1099508566 12:83507229-83507251 AGAAACAGAACGTTTGACCATGG + Intergenic
1099526368 12:83723153-83723175 GGAAACTGAACATTTGACTATGG + Intergenic
1099578081 12:84405433-84405455 GGAAGCTGAACATTTGAGTATGG + Intergenic
1099689785 12:85938079-85938101 GGAAACTGAACCTTTGACTATGG + Intergenic
1099735787 12:86565081-86565103 AGAAACTGAACATATGAATATGG + Intronic
1099821347 12:87715055-87715077 AGAAACTGAACACTTAACCATGG - Intergenic
1100083309 12:90878254-90878276 GAAAACTGGCCATTTGAATATGG + Intergenic
1100231955 12:92617896-92617918 AGAAACTGAACACTTGACCAGGG + Intergenic
1100241146 12:92711566-92711588 GGAAACTGAACATTTGACTATGG - Intergenic
1100821670 12:98437436-98437458 GGAACCTCAAAATTTGAATAAGG + Intergenic
1100899961 12:99227057-99227079 TGAAACTGAACAATACACTAGGG - Intronic
1101264137 12:103066164-103066186 GGAAACTGAACGTTTGCCTATGG + Intergenic
1101534661 12:105606062-105606084 GGAAATTGGACATTTGACAATGG - Intergenic
1101543077 12:105682678-105682700 GGAAATTGAACGTTTGACAATGG + Intergenic
1103035617 12:117654105-117654127 GGAAACTGTACATTTGGCTATGG + Intronic
1103396532 12:120611489-120611511 AGAAACTGAACATTTGACGATGG + Intergenic
1104742213 12:131186219-131186241 GGAAACTGTGCATCTGACAAGGG + Intergenic
1105740116 13:23315218-23315240 GGAAACTGGAAGTTTGACTGTGG + Intronic
1106054788 13:26228135-26228157 AGAAACTGAGCATCTGACCATGG - Intergenic
1107817709 13:44259004-44259026 AGGAACAGAACACTTGACTAAGG - Intergenic
1107983570 13:45755930-45755952 GGAAACTGAACGTTTGACTATGG - Intergenic
1108302427 13:49091943-49091965 GGAAACTGAATATTTGACTATGG - Intronic
1108914298 13:55588829-55588851 GTAAACTGAACGTTTGACTATGG - Intergenic
1108962658 13:56255290-56255312 GCAAACTGAAAAATTGACTTCGG - Intergenic
1109088518 13:58008514-58008536 ATAAAATAAACATTTGACTAAGG - Intergenic
1109274420 13:60287534-60287556 TGAGATTGAACATTTGACTTGGG + Intergenic
1109293230 13:60500160-60500182 GGAAACCGAACATTTGACTATGG + Intronic
1109519027 13:63484843-63484865 GGAAACTGAACGTTTGACTATGG + Intergenic
1109583054 13:64366209-64366231 GGAAACTGAACATTTGACTATGG + Intergenic
1109712677 13:66180780-66180802 AGAAACTGAACGTTTGACTGTGG - Intergenic
1109939157 13:69337082-69337104 GAAAACAAAACATTTAACTAAGG + Intergenic
1110112135 13:71761139-71761161 GGTAATTCAACATTTGATTAAGG - Intronic
1110166020 13:72444495-72444517 GCAAACTACACATTTGACAAAGG - Intergenic
1110377177 13:74806511-74806533 GGAAACTGAACGCTTGACTATGG + Intergenic
1110499399 13:76209181-76209203 GGGAAGTGAACATTTGAGGAGGG - Intergenic
1110685763 13:78372238-78372260 GCAAACTACACATTTGACAAAGG - Intergenic
1110834129 13:80064587-80064609 GGAGACTGAACGTTTGACTATGG - Intergenic
1111044406 13:82796025-82796047 AGAAACTAAATATTTGACTATGG + Intergenic
1111057794 13:82972985-82973007 GGAAACTGAACATTTGACTATGG - Intergenic
1111150817 13:84251883-84251905 AGAAACTGATTATTTGACCAAGG - Intergenic
1111517674 13:89356667-89356689 AGAATCTGAAGATTTGAATAGGG + Intergenic
1112231123 13:97590122-97590144 GGAAACTGAAAGCTTGACTGTGG - Intergenic
1112249923 13:97770236-97770258 GGAAACTGAATATTTGACTATGG - Intergenic
1113319700 13:109221621-109221643 GGAAACTGAATGTTTGACTATGG - Intergenic
1114205876 14:20570811-20570833 GGAAACTGAAAGTTTGACTATGG + Intergenic
1114758252 14:25283834-25283856 GGAAACTGAACGTTTGACTATGG - Intergenic
1115059721 14:29173936-29173958 GGAAACTGAACGTTTGACTATGG + Intergenic
1115126518 14:30001433-30001455 GGTTACTGAATATTTGAATAAGG - Intronic
1115130698 14:30049302-30049324 AGTAATTGAACGTTTGACTATGG + Intronic
1116058913 14:39896980-39897002 AGAAACTGAGTGTTTGACTATGG + Intergenic
1116158372 14:41236623-41236645 GGAAACTGAATATTTGAGTATGG - Intergenic
1116308039 14:43283405-43283427 AGAAACTGAACATTTGACTATGG - Intergenic
1116415077 14:44669352-44669374 GGAAACCGAATGTTTGACTACGG + Intergenic
1116531452 14:45978183-45978205 AGAAACTGAATGTTTGACTATGG - Intergenic
1116546194 14:46167991-46168013 GCAAACTGCACATATGACAAGGG - Intergenic
1117001606 14:51376355-51376377 GGAAATTGAATGTTTGACTATGG + Intergenic
1117192954 14:53311616-53311638 GCAAACTGTACATCTGACAAAGG + Intergenic
1117216849 14:53560217-53560239 GGAAACTGAATGTTTGACTATGG + Intergenic
1117573383 14:57072325-57072347 GTAAACTGAACAATTCTCTAGGG + Intergenic
1117634139 14:57724415-57724437 GGAAACTGAACGTTTGACTATGG + Intronic
1118122428 14:62860128-62860150 GGAAACTGAACATTTGACTATGG - Intronic
1118690631 14:68336209-68336231 GGAAACTGAATGTTTAATTATGG + Intronic
1118880768 14:69823976-69823998 GGAAACCGAACGTTTGACTATGG - Intergenic
1119059693 14:71462148-71462170 GGAAACTGAACATTTGACTATGG - Intronic
1120082017 14:80227488-80227510 GGAAACTGAATGTTTGACTATGG - Intronic
1120145843 14:80977475-80977497 TGAGACTGAATATTTGACCATGG - Intronic
1120231419 14:81845209-81845231 AGAAACTAAATGTTTGACTATGG - Intergenic
1120555986 14:85930396-85930418 GGAAACTGAATGTTTAACTATGG - Intergenic
1120562946 14:86018879-86018901 GGATACTGTACATTGGAATAAGG - Intergenic
1120638608 14:86982370-86982392 GGAAGCTTAGAATTTGACTAAGG - Intergenic
1120736560 14:88059438-88059460 GGAAACTATCCATTTGACAAAGG + Intergenic
1120973708 14:90230868-90230890 GGAAACTGAACATTTGACTATGG + Intergenic
1122169335 14:99859213-99859235 GGTAACTGAAAATCTAACTAAGG - Intronic
1122778624 14:104134317-104134339 GGAAACTGAACACTTGCCAGAGG - Intergenic
1123397034 15:19947372-19947394 GAAAACTGTTCATTTGACAAGGG - Intergenic
1123803611 15:23849025-23849047 GCAAACTGTACATCTGACAAGGG - Intergenic
1124619923 15:31267858-31267880 GGACACAGAACATATCACTAAGG - Intergenic
1126283616 15:46986319-46986341 GGAAACTGAAAATTTGTCTATGG + Intergenic
1128026197 15:64439077-64439099 GACGACTGAATATTTGACTAGGG - Intronic
1131504549 15:93005120-93005142 GTAAACTGTACATTGGAGTAGGG + Intronic
1131982165 15:98004762-98004784 GGAAAATGAACATGTAACAAGGG + Intergenic
1135061633 16:19275964-19275986 AGAAACTGAACGCTTGACTATGG - Intergenic
1135626010 16:23995538-23995560 GGAAACTGACGATTTGACCATGG + Intronic
1135814149 16:25616721-25616743 GGACACTGAACATTGAAGTAAGG + Intergenic
1136250946 16:29004633-29004655 GGAAACTGAATGTTTGACTATGG + Intergenic
1137312812 16:47282983-47283005 GCAAACTGAACATCTGACAAAGG - Intronic
1138848158 16:60592534-60592556 GGAAACTGAAAATTTTACAGTGG - Intergenic
1138868390 16:60850824-60850846 GGAAACTGAGTGTTTGACTATGG + Intergenic
1140420349 16:74814102-74814124 GGAAACTGAACAATTGAGCCTGG - Intergenic
1141559537 16:84857996-84858018 GGAAACTGAACGTTTGACTATGG - Intronic
1143050111 17:4118320-4118342 AGAAACTGAACATTGGACTATGG - Intronic
1145831873 17:27922809-27922831 GGAAACTAAAGATTTGAATCTGG + Intergenic
1146836361 17:36114042-36114064 GGAAACTGAACGTTTGACTATGG + Intergenic
1146850939 17:36221082-36221104 GGAAACTGAACGTTTGACTATGG + Intronic
1148531674 17:48399110-48399132 GGAAATTGAATATTTCACAAAGG + Intronic
1149241571 17:54656845-54656867 GGAAAGTGAAGATTTGACTCTGG + Intergenic
1150988353 17:70225836-70225858 GTGCACTGAACATTTGATTAAGG - Intergenic
1151037805 17:70821556-70821578 GGAAACTGAACATTTGACTATGG - Intergenic
1151825454 17:76521446-76521468 GGGAACTGAACAGCAGACTAGGG - Intergenic
1153089715 18:1330200-1330222 GGAAACTGAACGTTTGACTATGG + Intergenic
1153190887 18:2536771-2536793 GAAAACTGAGCAAATGACTAAGG - Intergenic
1154252666 18:12757237-12757259 GGAAACTTAATGTTTGACTATGG - Intergenic
1154506178 18:15042928-15042950 GGAAACTGAACTTTTGACTATGG + Intergenic
1155847368 18:30725695-30725717 GGAAACTCAAAATTTGATAATGG + Intergenic
1155940760 18:31799955-31799977 AGAAACTGAATGTTTCACTATGG + Intergenic
1156014204 18:32528889-32528911 GGGATATGAACATTAGACTATGG + Intergenic
1156018429 18:32572806-32572828 GCAAACTATACATCTGACTAAGG + Intergenic
1156303867 18:35858732-35858754 GGAAACTGGACATTTGACTGTGG + Intergenic
1156582556 18:38394502-38394524 GGAAACTGAACATTTGACTATGG + Intergenic
1156832989 18:41517578-41517600 TGAAAGTGAACATTTAAATATGG + Intergenic
1156990298 18:43400737-43400759 GGAAATTGAATGTTTGACTATGG - Intergenic
1156998584 18:43497767-43497789 GGAAACTGAACATCTGACTATGG + Intergenic
1157341208 18:46780065-46780087 GGAAACTGAACGTTTGACTACGG + Intergenic
1157998500 18:52588086-52588108 GGAAACTGAACGTTTGACTATGG - Intronic
1158867732 18:61654186-61654208 TGAAACTAAACATTTTCCTATGG - Intergenic
1159559100 18:69975313-69975335 GGAAACTGAACATTTGACTATGG - Intergenic
1159711303 18:71764162-71764184 AGAAACTGAACGTTTGACTATGG + Intronic
1159755111 18:72354714-72354736 GGAAACAGAACATTCAAATAGGG + Intergenic
1159907480 18:74109074-74109096 GGAAAATGATCATCTGACAAAGG + Intronic
1164097081 19:22021305-22021327 AAAAACTGAACTTTTGACTATGG - Intergenic
1166622769 19:44317550-44317572 GCAAACTGACCATCTGACCAGGG - Intergenic
1167951587 19:53031964-53031986 AGAAACTGAATATTTGACTATGG + Intergenic
925279958 2:2676906-2676928 GGAAACTGAACGTTAGACTACGG + Intergenic
925460731 2:4060484-4060506 GGAAACTGAATGTTTGACTATGG + Intergenic
925650382 2:6083262-6083284 GGATACTGAAAATTTGCCAAGGG - Intergenic
926810389 2:16750638-16750660 GGAAACTGAATGTTGGACTATGG - Intergenic
926826768 2:16913706-16913728 GGAAACTGAACGTTTGACTGTGG + Intergenic
927008724 2:18879762-18879784 GGAAACTGAATGTTGGACTATGG + Intergenic
927660437 2:24988707-24988729 GGAAACTGAACATTTGACTATGG + Intergenic
928478956 2:31661324-31661346 GGAAATTGAACACCTGACCATGG - Intergenic
928693780 2:33827609-33827631 GCAAACTGCACATCTGACAAAGG - Intergenic
929269821 2:39960743-39960765 AGAAACTGAACGTTTGATTATGG - Intergenic
929550265 2:42886070-42886092 AGAAACTAAACACTTGACCATGG + Intergenic
930141547 2:47955798-47955820 GCAAACTATACATTTGACAAAGG + Intergenic
930910156 2:56620937-56620959 GGAAACTGAACATTTGACTATGG + Intergenic
931779801 2:65569397-65569419 GCAAACTATACATTTGACAAAGG - Intergenic
931962045 2:67493037-67493059 GGACACTGAACATTGGAGGAAGG - Intergenic
932584197 2:73014355-73014377 GGAAATTTAAGATTTGACTAAGG - Intronic
932870700 2:75395043-75395065 GGAAACTGAATGTTTGAATATGG - Intergenic
932989041 2:76764077-76764099 TGAAACTGAATATTTAGCTAAGG + Intronic
933394459 2:81713317-81713339 GAAAACTAAACGTTTGACTATGG - Intergenic
935183941 2:100714939-100714961 GGAAACTGAATGTTTGACTATGG + Intergenic
935425104 2:102911287-102911309 GGAAACTGAACGTTTGACTATGG - Intergenic
935556879 2:104519702-104519724 GGAAACTGAACATTTCAAGATGG + Intergenic
935564305 2:104590213-104590235 GAAAACTGAACATTTGACTATGG - Intergenic
936641230 2:114314730-114314752 TAAAACTGAATGTTTGACTATGG + Intergenic
936890847 2:117367835-117367857 GCAAACTACACATCTGACTAAGG + Intergenic
937282754 2:120731572-120731594 GGGACATGAACATTCGACTATGG - Intergenic
937582058 2:123499127-123499149 GGAAACTGAAAGTTTGACTATGG - Intergenic
937785201 2:125887688-125887710 TGAAACTGAACATTTGACTATGG - Intergenic
937852564 2:126648698-126648720 GGAAACTGAATGTTTGACTATGG - Intergenic
938191514 2:129285974-129285996 GCAAACTATACATTTGACAAAGG - Intergenic
939020053 2:136947837-136947859 GGAAACTTAACACTTCACTGTGG + Intronic
939069068 2:137517896-137517918 GGAAACTGAATGTTTGACTGTGG + Intronic
939080853 2:137660161-137660183 ATAAACTGAATATGTGACTATGG + Intronic
939213878 2:139212280-139212302 GGAAACTGAACGTCTGACTGTGG + Intergenic
940000400 2:148961624-148961646 GGGTACTGAACATTTGAAAAAGG + Intronic
940472084 2:154113087-154113109 GGAAACTGAATGTTTGCCTACGG - Intronic
940605910 2:155924248-155924270 GGAAACTGAACGTTTGACTATGG - Intergenic
941000917 2:160203119-160203141 GGAAACTGAACCTTTTATAATGG - Intronic
941330663 2:164174525-164174547 GTAAACTGAACACTTGACTATGG - Intergenic
941668023 2:168261168-168261190 GGACACGGAACGTTTGACTATGG + Intergenic
943225949 2:185176427-185176449 GGAAACTGCACAATTTACCACGG - Intergenic
943239213 2:185362532-185362554 GGAAACTGAACATTTGACTACGG - Intergenic
943253612 2:185564964-185564986 GCAAACTGTACATCTGACAAGGG + Intergenic
943317924 2:186412279-186412301 GGAAACTGAACGTTTGACTATGG - Intergenic
943384058 2:187181050-187181072 GGAAACAGAATGTTTGACTATGG - Intergenic
943772574 2:191734407-191734429 CTAAACTGAACATTTCACTTAGG - Intergenic
944037547 2:195313679-195313701 GGAAACAGAAAAATGGACTAGGG + Intergenic
945717830 2:213380630-213380652 GGAAACTGAATGTTTGACTATGG - Intronic
945725840 2:213471455-213471477 GGAAACTGAACGTTTGACTATGG - Intronic
946527861 2:220539927-220539949 GGAAACTGAACATTTGACTATGG - Intergenic
946703769 2:222437752-222437774 GGAAACTGAAGATTTGACTATGG - Intronic
946790926 2:223299800-223299822 AGAAACTGAACTTTTGACTATGG + Intergenic
947766075 2:232638362-232638384 GGAAGAGGAACATTTGGCTATGG + Intronic
948511009 2:238465305-238465327 TGAAACTGACCATTAGAATATGG - Intergenic
1169235207 20:3925013-3925035 GGAAACTGAACGGATGAGTAAGG + Intronic
1169887491 20:10416661-10416683 GGTAACTGAATAGTTGACGATGG + Intronic
1170041295 20:12042578-12042600 GCAAACTACACATTTGACAAAGG - Intergenic
1170092306 20:12604079-12604101 AGAAAATGAACACTTGACCATGG - Intergenic
1170577402 20:17674854-17674876 GGAAACAGAACATTTGTTTTGGG - Intronic
1171088578 20:22262537-22262559 GCAAACTGAACATTTAGATAAGG - Intergenic
1171143839 20:22764964-22764986 GGCAACTTAACATGTGACTCAGG + Intergenic
1176743544 21:10630240-10630262 GAAAACTGTTCATTTGACAAGGG - Intergenic
1176791675 21:13326096-13326118 GGAAACTGAACTTTTGACTATGG - Intergenic
1176998166 21:15580224-15580246 GGAAACTGAACATTTGACTATGG + Intergenic
1177139410 21:17342229-17342251 GGAAACTGAACATTTGACTATGG - Intergenic
1177505555 21:22014142-22014164 GGAAACTGAACGTTTGACTATGG - Intergenic
1177758749 21:25378702-25378724 GCAAACTATACATTTGACAAAGG + Intergenic
1177930556 21:27277784-27277806 GGAAACTCAACATGTGACAGAGG - Intergenic
1177933692 21:27316892-27316914 GGAAACTGTATATTTGACTGTGG - Intergenic
1177936200 21:27349220-27349242 GCCAACTGAACATGTAACTAAGG - Intergenic
1177991066 21:28037098-28037120 GGAAACTGAACTTTTGACTATGG - Intergenic
1178012665 21:28305215-28305237 GGAAACTGAACGTTTGACTATGG + Intergenic
1179295893 21:40062105-40062127 GAAAACTGAACATTTGAAGAGGG + Intronic
1180591142 22:16938327-16938349 GGAAACTGATCATTTGACTATGG - Intergenic
1182290264 22:29272012-29272034 TTAAACTCAACATTTGACTGTGG - Intronic
1183178416 22:36241312-36241334 GCAAACTGTGCATTTGACAAAGG - Intergenic
1184572938 22:45338067-45338089 GGAAAAAGAACATGTGAGTAAGG - Intronic
1184603555 22:45558335-45558357 GGAAACTGAATGTTTGACTCTGG - Intronic
949125659 3:443106-443128 GGAAACTGAATGTTTGCCTACGG - Intergenic
949170035 3:986564-986586 TGAAACTGAACATTTAACTATGG - Intergenic
949245873 3:1924962-1924984 GGAAACTGAACGTTTGACTATGG + Intergenic
949417587 3:3830843-3830865 GGAAACTGAACGTTTGACCATGG - Intronic
949638785 3:6012556-6012578 GGAAACTGAACATTTGACTATGG + Intergenic
951003623 3:17592891-17592913 GGAAACTGAATGTTTGACTATGG + Intronic
951122577 3:18945606-18945628 GGAAACTGAATGTTTGACTACGG + Intergenic
951384532 3:22027574-22027596 GGAAACTGGACATTTGACTATGG + Intronic
951674665 3:25224105-25224127 GGAAACTGAACTCTTGAAAATGG + Intronic
951970758 3:28441826-28441848 GGAAACTGAATATTTGACTATGG - Intronic
952546620 3:34427089-34427111 GCAAACTATACATTTGACAAAGG + Intergenic
952605437 3:35141976-35141998 GGAAACTGAACATTTGGCTATGG - Intergenic
952957725 3:38567685-38567707 GGCAACTGAACACGTCACTAGGG + Intronic
953098265 3:39800188-39800210 GCAAACTGCACAACTGACTAAGG - Intergenic
954054161 3:48007999-48008021 GGAAATTGAATGTTTGACTATGG + Intronic
954511485 3:51129622-51129644 GGAAACTGAACGTTTGACTATGG - Intronic
955035590 3:55264131-55264153 GGAAACTGAACATTTGACTATGG + Intergenic
955497704 3:59552648-59552670 GGACACTGAATATATGACAAGGG - Intergenic
956306881 3:67835661-67835683 GGAAATTGAACATTTGACCAAGG + Intergenic
956360458 3:68441477-68441499 GGAAACTGAACGTTTAACTATGG + Intronic
956454384 3:69406495-69406517 GGAAAGTGAATATTTTACAATGG - Intronic
956946204 3:74226418-74226440 GAAAACTTAACATTTCAGTAGGG - Intergenic
957247578 3:77733858-77733880 GGAAACTGAACATTTGACTATGG - Intergenic
957458331 3:80482771-80482793 GCAAACTATACATTTGACAAAGG + Intergenic
957754603 3:84469465-84469487 GGAAACTGAATGTTTGACTATGG + Intergenic
957989945 3:87614794-87614816 GAAAACTGAGCATTTGAGGAGGG + Intergenic
958263467 3:91409185-91409207 GGAATCTGAACCTTTTATTATGG - Intergenic
958487672 3:94732435-94732457 GGAAACTGAACGTTTGACTATGG - Intergenic
958495026 3:94834049-94834071 GCAAACTATACATCTGACTAAGG + Intergenic
958762114 3:98321419-98321441 AGAGACTGAACACTTAACTATGG - Intergenic
958934308 3:100240667-100240689 GGAAACTGAACGTTTGACTATGG + Intergenic
959203645 3:103279206-103279228 GGAAACTGAACGTTTGACTATGG - Intergenic
959527127 3:107389739-107389761 GCAAACCGAACATCTGACAAAGG - Intergenic
959746009 3:109777234-109777256 AGAAAATGAACATTTGACTATGG - Intergenic
959997865 3:112698359-112698381 GGAAACTGAACGTTTGACTATGG + Intergenic
960349534 3:116575740-116575762 GGAAACTGAACATTTGACTATGG + Intronic
960494741 3:118360741-118360763 GGAAACTGAAGGTTTGACTATGG - Intergenic
960510782 3:118546594-118546616 GGAAAGTGAAGATTTTATTAAGG - Intergenic
961710977 3:128827976-128827998 AGAAACTGAACATTTGACTATGG - Intergenic
963331811 3:143923334-143923356 GGAAACTGAATGTTTGAATATGG - Intergenic
963355656 3:144206821-144206843 GGAAACTGAATGTTTGACTATGG - Intergenic
963453676 3:145516706-145516728 GGAAATTGAACGTCTGACTATGG + Intergenic
963630314 3:147723259-147723281 GGAAACTGAATGTTTGACTATGG + Intergenic
964679239 3:159318875-159318897 GGAAACTGAATGTTTGACTATGG - Intronic
965226761 3:166000725-166000747 GGAAACTGACCTTTTGACTATGG - Intergenic
965291738 3:166889549-166889571 GGAAACTGAACTTTTGACTAAGG - Intergenic
966044324 3:175530882-175530904 GGAAACTAAATGTTTGACTATGG - Intronic
966086573 3:176075385-176075407 GTAAACTGCACATCTGAATAAGG + Intergenic
966445698 3:179998598-179998620 GGAAACTGAACGTTTGACAATGG + Intronic
967202846 3:187089059-187089081 GGAAACCGTACATTTGATAAGGG - Intergenic
967560110 3:190907172-190907194 GGAAACTGAAGACTTGACTAGGG - Intergenic
967831782 3:193926029-193926051 GGAAACTGAACGTTTGACTGTGG + Intergenic
968800189 4:2738160-2738182 GGAAACTGAATGTTTGACTATGG + Intergenic
968906952 4:3458006-3458028 GGAAACTGAACATTTGACTATGG + Intergenic
970002098 4:11374473-11374495 AGAAACTGAATGCTTGACTATGG + Intergenic
970816409 4:20161344-20161366 AGAGACTGAACACTTGACCATGG + Intergenic
970876573 4:20877535-20877557 GGAAACTGAAGACTAGACAAGGG - Intronic
971101009 4:23466383-23466405 AGAAACTGAACATTTGACTGTGG - Intergenic
971817232 4:31505114-31505136 GGAAACTGAACATTTGACTGTGG + Intergenic
971979289 4:33732834-33732856 GGAAACTGAACGTTTGACTGTGG - Intergenic
972085228 4:35207141-35207163 AGAAACTGACGGTTTGACTATGG + Intergenic
972095499 4:35342728-35342750 AGGAACTGAACATTTGACTATGG + Intergenic
972201297 4:36717150-36717172 GGAAACTAAACGTTTGATCATGG - Intergenic
972760335 4:42097039-42097061 GGCAACTGGACATTTGAGTCTGG - Intergenic
972805921 4:42529366-42529388 GGAAACTGAACATTTGACCATGG + Intronic
972882955 4:43448115-43448137 GGAAACTGAACGTTCGACTATGG - Intergenic
973102930 4:46294791-46294813 AGAACATGAACATTCGACTATGG + Intronic
973118447 4:46489082-46489104 AGAAACTGAACATTTGATAATGG + Intergenic
974262365 4:59542230-59542252 GGAAACTGATCATTTGACTATGG - Intergenic
974289573 4:59912781-59912803 AGCAAGTAAACATTTGACTATGG + Intergenic
974564794 4:63568351-63568373 AGAAACTGAATGTTTGACTATGG + Intergenic
974727218 4:65812562-65812584 GGAAACTGAATGTTTAACTATGG + Intergenic
974746910 4:66088866-66088888 GGAAACTGAATGTTTGACTACGG - Intergenic
975247184 4:72132897-72132919 GCAAACTTTGCATTTGACTAAGG - Intronic
975386712 4:73767470-73767492 AGAAACTGAACATTTGACTATGG - Intergenic
975982610 4:80177238-80177260 GGAAACTGAATGTTTGACTATGG - Intergenic
976034201 4:80795783-80795805 GGAAACTGAATGTTTGACTATGG - Intronic
976073197 4:81265714-81265736 GCAAACTGCTCATTTGACAAGGG - Intergenic
977204721 4:94155723-94155745 GGAAACTGAACATTTGACTATGG + Intergenic
977430772 4:96928251-96928273 GGAAACTGAATGTTTGACTATGG + Intergenic
977466006 4:97383413-97383435 GGAAACTGAACATTTGACCATGG + Intronic
977490066 4:97700032-97700054 AGAAACTGAACGTTTGACTATGG - Intronic
977626270 4:99192615-99192637 GGAACCTGAATGTTTGACTATGG - Intergenic
977739890 4:100466763-100466785 AGAAACTCAACATTTGAGGATGG + Intronic
977833270 4:101618129-101618151 GAAAACTGAACATTTGACTATGG - Intronic
977847092 4:101779182-101779204 AGAAACTGAACACTTGAACATGG - Intronic
977930406 4:102743780-102743802 GGAAACCAAACCTTTGACTACGG - Intronic
978341584 4:107725510-107725532 GGAAACTGAATGTTTGACTATGG - Intergenic
978772147 4:112467741-112467763 GAAAACCGAACGTTTGACTATGG - Intergenic
978899069 4:113926779-113926801 GGAAACTGAACGTCTGACTATGG - Intronic
978966857 4:114750981-114751003 GGAAATTGAATTTTTGACTATGG + Intergenic
979033832 4:115686102-115686124 GGAAACTATCCATCTGACTAAGG - Intergenic
979767025 4:124474634-124474656 AGAAACTGAACGTTTGACTATGG + Intergenic
979888561 4:126062134-126062156 GAAAACTGAATGTTTGGCTATGG - Intergenic
979898397 4:126189018-126189040 AGAAACAGAATGTTTGACTATGG - Intergenic
979988111 4:127340453-127340475 GTAAACTGAAGGCTTGACTAGGG + Intergenic
980083971 4:128372605-128372627 GGAAACTGAGCATTTTGCTGAGG + Intergenic
980385785 4:132086992-132087014 AGAAACTGAACATTTGACTATGG - Intergenic
980387942 4:132111142-132111164 GGAAACTGAATGCTTGACTATGG - Intergenic
980405885 4:132353752-132353774 GGAAACCGAACATTTGACTATGG - Intergenic
980473887 4:133285174-133285196 GCAAACTATACATTTGACAAAGG - Intergenic
980497521 4:133605323-133605345 GGAAACTGAATGTTTGACTATGG - Intergenic
981462815 4:145031837-145031859 GGAAACTGAATGTTTGACTATGG + Intronic
981835009 4:149043984-149044006 GGAAATTGAATGTTTGAGTATGG + Intergenic
981873543 4:149515235-149515257 GGAAACCAAACGTTTGACTATGG + Intergenic
981901066 4:149864198-149864220 GGAAACTAACCATCTGACAAGGG + Intergenic
982597772 4:157406987-157407009 AGAAACTGAATATTTAACTATGG - Intergenic
982623335 4:157732862-157732884 GGAAACTGAATGTTTGACTATGG - Intergenic
982686303 4:158493552-158493574 GGAAACTGAAAATTTAAGTGTGG + Intronic
982835545 4:160116680-160116702 GGAAACTGAAAGTTTGACTATGG + Intergenic
982847774 4:160274335-160274357 GGAAACTCAACGTTTGACTATGG + Intergenic
983027396 4:162755334-162755356 GGAAGCTGAATGCTTGACTATGG + Intergenic
983185069 4:164691614-164691636 GGAAACTGAACGTTTGACTATGG + Intergenic
983580936 4:169309427-169309449 AGAAACTGCACCTTTTACTAGGG - Intergenic
983582680 4:169324851-169324873 GGAAACTGAACATTCAACTATGG + Intergenic
984060278 4:174981985-174982007 GGAAATTGAATGTTTGACTATGG - Intergenic
984443884 4:179808827-179808849 GGAAACTACACATCTGACAAAGG + Intergenic
984581004 4:181509974-181509996 GGAAAGTGAGCATTTAATTAGGG - Intergenic
984607569 4:181803347-181803369 GGAAATTGAAGTTTAGACTAAGG + Intergenic
985817218 5:2135813-2135835 GGAAAATGAAGCTTAGACTATGG - Intergenic
986025579 5:3847453-3847475 GGAAACTGAATGTTTGACTATGG + Intergenic
986037027 5:3950398-3950420 GGAAACTGAACGTTTAACTATGG - Intergenic
986087114 5:4462757-4462779 GGAAACTGAACTTTTGACTATGG + Intergenic
986742925 5:10719545-10719567 GGAAACTGAACATTTGACTATGG + Intronic
986929310 5:12797792-12797814 AGAAACTGAAAATTTATCTATGG - Intergenic
986938326 5:12918711-12918733 GGAAACTGAATGTTTAATTATGG - Intergenic
987153182 5:15061705-15061727 GGAAACTGAACGTTTGATTATGG + Intergenic
987571796 5:19673236-19673258 AGAAACTAAACTATTGACTAAGG + Intronic
987657132 5:20821612-20821634 GGAAACTGAACATTTAACTGTGG - Intergenic
987885450 5:23806539-23806561 GGAAACTGAACATTTGACTATGG + Intergenic
988056563 5:26105228-26105250 GGAAACTGAATGTTTTACTGTGG - Intergenic
988079825 5:26401380-26401402 GGAAACTGAATGTTTGACTATGG - Intergenic
988107763 5:26772586-26772608 GGAAACTGAATGTTTGACTATGG + Intergenic
988160819 5:27516831-27516853 GGAAACAAAACGTTTGACTATGG - Intergenic
988188781 5:27901276-27901298 GGAAATGGAACATATGACTATGG + Intergenic
988228774 5:28448166-28448188 GCAAACTGAAGGTTTGACTATGG + Intergenic
988562136 5:32290887-32290909 AGAAACTGAATGTTTGACTATGG + Intronic
988766419 5:34382336-34382358 GGAAACTGAACATTTGACTGTGG + Intergenic
989097835 5:37797359-37797381 GGAAACTGAACGTTTGACTATGG + Intergenic
989307497 5:39974583-39974605 GGAAACTGAATATTTGACTATGG - Intergenic
989457637 5:41661728-41661750 GGAAACTGAACGTTTGACTTTGG - Intergenic
989486378 5:41996319-41996341 GGAAACTGAACGTTTGACTATGG - Intergenic
989996846 5:50844822-50844844 AGAAAATGAACATTTGAGAATGG + Exonic
991033550 5:62105962-62105984 GGAAACTGAACATTTAACTATGG + Intergenic
991330733 5:65489644-65489666 AGAAACTGAATGTTTGACTATGG - Intergenic
991946152 5:71900181-71900203 GGAAACTGAATGTTTGACTATGG + Intergenic
992591208 5:78297496-78297518 GGAAACAGAAAATTTGATAAAGG - Intergenic
992953605 5:81885776-81885798 GGAAAATGTACATTTAACAATGG + Intergenic
993203397 5:84847580-84847602 GGAAACTGAACATTTGACTATGG + Intergenic
993231896 5:85247493-85247515 GAAAACTGAACATTTGACTATGG - Intergenic
993367463 5:87050916-87050938 GGAAACCGAATGTTTGACTATGG - Intergenic
993412576 5:87591772-87591794 GGAAACTGAACGCTTGACTATGG - Intergenic
993791795 5:92218951-92218973 GGAAACTGAACATTTGATTATGG + Intergenic
994291366 5:98031931-98031953 GGAAACTGAACGTTTAACTATGG - Intergenic
994855431 5:105113544-105113566 GGAAACTGAATGTTTGACTATGG - Intergenic
994984415 5:106915689-106915711 GTAAACTGAATGTTTGACTGTGG - Intergenic
996018564 5:118567896-118567918 AGAAACTGAATGTTTGACTATGG + Intergenic
996164951 5:120212468-120212490 AGAAACTGAACATTTGACTATGG - Intergenic
996392199 5:122973745-122973767 AGAAACTGAACGCTTGACTATGG - Intronic
996825568 5:127677875-127677897 GGAAACTGAACACTTGACCATGG + Intergenic
996912236 5:128669014-128669036 AGAAACTGAACATTTGACCATGG + Intronic
997564505 5:134876581-134876603 GGAAACAGCACATTTAACTTGGG - Intronic
998290330 5:140908511-140908533 GGAAACTGAACATTTGACTATGG - Intronic
998326057 5:141280697-141280719 AGAGATTGAACATCTGACTATGG + Intergenic
998881432 5:146649242-146649264 GGTAACTGAACAATTGACCTAGG - Intronic
999351391 5:150874885-150874907 GGAAACTGAACATTTGACTATGG + Intronic
1000457795 5:161473552-161473574 GGAAAAAGAACATTAGAATAAGG + Intronic
1001173600 5:169444685-169444707 AAAAACTGAACATTTGACTATGG + Intergenic
1002685463 5:181005841-181005863 GGACACTGGACATATGAATATGG - Exonic
1002997971 6:2304786-2304808 GGAAACTGAACAATTGACTATGG + Intergenic
1003354434 6:5353792-5353814 GCAAACTGTACATCTGACAAGGG - Intronic
1003758612 6:9150122-9150144 GGAAACTGACCGTTTGACTGTGG + Intergenic
1003791226 6:9550032-9550054 GGAAACTAAACATTTGACTATGG + Intergenic
1004137392 6:12980819-12980841 GAAAAATGAAAATATGACTAAGG - Intronic
1004824284 6:19403195-19403217 GGAAACTGAACATTTGACTATGG - Intergenic
1005185174 6:23157113-23157135 GGAAACTGAACGTTTGACTATGG + Intergenic
1006062356 6:31433263-31433285 AGAAACTGAACATTTGACTATGG + Intergenic
1007200302 6:40102452-40102474 GGAAACTGGAAATCTTACTATGG + Intergenic
1008069136 6:47081848-47081870 GGAAACTGAGCAAATGACAAAGG - Intergenic
1008079352 6:47178359-47178381 GGAAACTGAACATTTGACTATGG - Intergenic
1008266917 6:49439248-49439270 GGAAACTGAATGTTTGACTATGG - Intronic
1008371212 6:50733126-50733148 GAAAAGTGAACATTTTAGTAAGG + Intronic
1008590457 6:52988755-52988777 GAAAACGGAAAATTTGAATATGG + Intronic
1008820405 6:55625193-55625215 GGAAACTGGATGTTTGACTATGG + Intergenic
1008991967 6:57613788-57613810 GGAATCTGAACATTTTATTATGG + Intronic
1009180567 6:60512736-60512758 GGAATCTGAACCTTTTATTATGG + Intergenic
1009308643 6:62122343-62122365 AGAAACTGAATGTTTGACTATGG + Intronic
1009390106 6:63135037-63135059 GGAGACTGAACATTTGACTATGG - Intergenic
1009524107 6:64721314-64721336 GGAAACTGCAATTTTAACTATGG + Intronic
1009646018 6:66402810-66402832 GGAAACTGAACAATATATTAGGG - Intergenic
1009660690 6:66606881-66606903 AGAAACTGAACTTTTGACTATGG - Intergenic
1009806500 6:68606993-68607015 TGAAACTGAATATTTGAATATGG + Intergenic
1009851921 6:69208917-69208939 GGAAACTGAATGTTTGACCATGG - Intronic
1009896914 6:69763143-69763165 TGAAACTGAATATTTAGCTAAGG + Intronic
1010108003 6:72190864-72190886 GGAAACTGAATGTTTGACCATGG - Intronic
1010323583 6:74540530-74540552 GGAAACTGAATGTTTGACTATGG + Intergenic
1010325324 6:74556558-74556580 GGAAACTGAACGTTTGACTATGG - Intergenic
1010818636 6:80388448-80388470 AGAAACTGAACATTTGACTATGG + Intergenic
1011043682 6:83058905-83058927 TGAAATTGAACTTTTGACTCAGG - Intronic
1011069108 6:83361706-83361728 GGAAACTGAACATTTGACTATGG + Intronic
1011452027 6:87503280-87503302 GTCAACTGAAGACTTGACTACGG + Intronic
1011871955 6:91906449-91906471 GGAACCTGAAAATGTGACTGGGG - Intergenic
1012001911 6:93664487-93664509 AAAAACTGAACCTTTGACTGTGG + Intergenic
1012108564 6:95197696-95197718 GGAAACTGAAAGTTTGACTATGG - Intergenic
1012344594 6:98170360-98170382 GGAAACTGAACGTTTGACTGTGG + Intergenic
1012355900 6:98314094-98314116 GGAAACAGAACATCTGACAAAGG + Intergenic
1012730468 6:102874360-102874382 GGAAACAGAACATTTGATATGGG + Intergenic
1012920789 6:105219504-105219526 GGAAACTGAACGTTTGACGATGG - Intergenic
1013406677 6:109849843-109849865 GGTAACTGAATGTTTGACTATGG + Intergenic
1013904658 6:115200510-115200532 AGGAACTGAAAATTTGTCTATGG + Intergenic
1014416991 6:121195430-121195452 GGAAACTGAATGTTTGACTGTGG + Intronic
1014534192 6:122596581-122596603 AGAAACTGAACGTTTGACTATGG - Intronic
1014631647 6:123796842-123796864 GGGAACTGAACGTTTGACTATGG + Intergenic
1014882483 6:126740635-126740657 AGAAACAGAAGATTTGACAAAGG - Intergenic
1015040781 6:128716318-128716340 GGAAACTGAAAATGTGAATTTGG - Intergenic
1015076125 6:129159693-129159715 GGAAACCTAATATTTCACTATGG + Intronic
1015466842 6:133557675-133557697 GGAAACGGAACATTTGACTATGG - Intergenic
1015475753 6:133657532-133657554 TGAAACTGAACGTTTGACTATGG + Intergenic
1015799856 6:137049281-137049303 GGAATATAAACATTTGGCTATGG + Intergenic
1016119911 6:140332651-140332673 AGAAACTGAACGTTTGACTATGG - Intergenic
1016132834 6:140497969-140497991 AGAAACTGAACAATTAACTGTGG - Intergenic
1016144295 6:140649443-140649465 GAAAACGGAAAGTTTGACTATGG + Intergenic
1016147325 6:140692675-140692697 GGAAACTGAATGTTTGACTGTGG - Intergenic
1016174909 6:141069054-141069076 GGAAACTGAACATTTGCATATGG - Intergenic
1016419609 6:143870641-143870663 GGAAACTGAACGTTTGACTGTGG - Intronic
1016576253 6:145572546-145572568 GGAAACTGAACATTTGCATATGG - Intronic
1016666071 6:146641993-146642015 GCAAACTGTACATCTGACCAAGG + Intronic
1017388450 6:153912166-153912188 GGAAACTGAACATTTGACTATGG - Intergenic
1017655680 6:156627035-156627057 GGAAATTGAACATCTGGCAAAGG - Intergenic
1017977111 6:159368016-159368038 GGAAACTGAACGTTTGACTATGG - Intergenic
1018122923 6:160655182-160655204 GGTAACTGAACGTTTGACTGTGG - Intronic
1018286405 6:162243810-162243832 GGAAACAAAACATTTCTCTAAGG - Intronic
1018535025 6:164810453-164810475 AGAAACTGAACGCTTGACTATGG - Intergenic
1018758508 6:166870293-166870315 GGAAACTTAACATTTCACATTGG - Intronic
1018803785 6:167242950-167242972 GGAAACTGAACATTGGACTATGG - Intergenic
1019809648 7:3155758-3155780 GAACACTGCACATTTGATTAAGG + Intronic
1020396723 7:7725555-7725577 GGAAACTGAACGTTTGACTATGG + Intronic
1020974810 7:14991678-14991700 GCAAACTGTACATCTGACAAAGG + Intergenic
1021147803 7:17110583-17110605 AGAAACTGATTATTTTACTAAGG + Intergenic
1024040543 7:45550185-45550207 GGAAACTGATCGTTTGACCGTGG + Intergenic
1024866107 7:53906384-53906406 AGAAACTGAATGTTTGACTATGG + Intergenic
1026046485 7:66909058-66909080 GGAAACTGAACATTTGACTATGG - Intergenic
1027685802 7:81277995-81278017 AGAAACTGAACGTTTGACTATGG + Intergenic
1028043866 7:86091506-86091528 GGAAACTGAACATTTGACTAGGG + Intergenic
1028141741 7:87282024-87282046 GGAAACTGAACCTTTGACTATGG + Intergenic
1028218220 7:88161557-88161579 GTAAACTATACATTTGACAAAGG + Intronic
1028237826 7:88382861-88382883 GGAAACTGAACGTTCAACTATGG + Intergenic
1028388924 7:90292466-90292488 AGAAACTGATTATTTTACTAAGG - Intronic
1028935019 7:96455103-96455125 GGAAACTGAATGTTTGACTATGG + Intergenic
1029961261 7:104691088-104691110 AGAAACTGAATGTTTGACTGTGG + Intronic
1030192284 7:106821738-106821760 AGAAACTGAACATTTGACCATGG + Intergenic
1030277463 7:107736154-107736176 GGAAACTGAATGTTTGACTAAGG + Intergenic
1030368759 7:108674067-108674089 GGAAACCGAACATTTGACTATGG + Intergenic
1030931281 7:115525643-115525665 GGAAACTGAACGTGTTACTATGG - Intergenic
1031025708 7:116677391-116677413 GAAAACTAACCATTTCACTAGGG + Intronic
1031236831 7:119188055-119188077 AGAAACTAAACATTTCACCATGG + Intergenic
1031676563 7:124618404-124618426 GGAAAATGAACGTTTGACTATGG + Intergenic
1031833002 7:126650056-126650078 GGAAACTGAATATTTGACTATGG + Intronic
1032153100 7:129446918-129446940 GGAAACTGAACGTTTGACTATGG - Intronic
1032287848 7:130556138-130556160 GGAACCTGAACATTTTACAGTGG + Intronic
1032344203 7:131105105-131105127 GGAAAATGTACCTTTGCCTAAGG - Intergenic
1032661968 7:133994034-133994056 GGAAGCTGAACATTGGTCTTTGG - Intronic
1032856330 7:135836654-135836676 GGAATCTGGACCTTTGACTTGGG + Intergenic
1032923466 7:136576076-136576098 AGAAACTGAACATTTGACTATGG - Intergenic
1033035595 7:137873289-137873311 GGAACCTGAGCATAGGACTAGGG + Intergenic
1033076264 7:138253085-138253107 GGAAACTGAACGTTTGACGGTGG + Intergenic
1033226254 7:139564812-139564834 GTAAACTAAACAATTGACTGTGG - Exonic
1034117642 7:148598219-148598241 GGGAACTGAACATTTCAATATGG - Intronic
1035656493 8:1310872-1310894 GAAAACTGGAAATTTGACAATGG + Intergenic
1036110086 8:5889236-5889258 GCAAAAAGAACATATGACTAAGG - Intergenic
1037364590 8:18108236-18108258 GGAAACTGAACATTTGACTATGG - Intergenic
1037460572 8:19104354-19104376 GGAAGCTGAAGAAATGACTAAGG + Intergenic
1039324162 8:36466486-36466508 GGAAACTGAACGTTTGACTCGGG - Intergenic
1039626538 8:39060111-39060133 AGAAATTGAACATTTAACCATGG - Intronic
1040412558 8:47169168-47169190 GGAATCTGAGCATCTGCCTAGGG + Intergenic
1040553082 8:48453654-48453676 GGAAACTGACGATCTGAATAAGG + Intergenic
1040676755 8:49759262-49759284 GGAAACAGAACATTGGTATAGGG - Intergenic
1041003166 8:53471656-53471678 GTAAACTGAAAATGTGACCAAGG - Intergenic
1041934558 8:63321369-63321391 GGAAACTGAACGTTTGACTATGG + Intergenic
1042001056 8:64123958-64123980 GGAAACTGAACTTTTGACTATGG - Intergenic
1042085609 8:65105601-65105623 AGAAACTGAACATTTAACCATGG - Intergenic
1043259966 8:78184154-78184176 GGAAACTGAACGTTTGACTATGG - Intergenic
1043308628 8:78829617-78829639 GCAAACTGTACATCTGACAAGGG + Intergenic
1044150804 8:88773114-88773136 GGAAACTGAACATCTGACTATGG + Intergenic
1044202396 8:89452527-89452549 GGAAACTGAATGTTTGACTATGG + Intergenic
1044436288 8:92167543-92167565 AGAAACTGAATAATTGTCTATGG - Intergenic
1044487146 8:92767083-92767105 GGAAACTGAATGTTTGACTATGG - Intergenic
1044633152 8:94298367-94298389 GAAAACTGAATGTTTGACTATGG - Intergenic
1045221844 8:100207104-100207126 GGAAACTGAACATTTGACTATGG + Intronic
1046128668 8:109941563-109941585 GGAAACTGAACGTTTGACTATGG - Intergenic
1046197563 8:110884262-110884284 GGAAACTCAGTGTTTGACTATGG + Intergenic
1046585780 8:116147680-116147702 GGAAATTGAACATTTGACTATGG - Intergenic
1047637552 8:126781047-126781069 GGAAACTGAACTTTTAAATGGGG - Intergenic
1050482680 9:6102642-6102664 GGAAACCGAACGTTAGACTATGG + Intergenic
1050797730 9:9565771-9565793 GGAAACAGAACATTAAACTTTGG + Intronic
1050878298 9:10668874-10668896 GCAAACTGTGCATTTGACAAAGG - Intergenic
1051882152 9:21850701-21850723 GGAAAGTGAACTTTTGACTATGG + Intronic
1052227595 9:26108415-26108437 GGAAACTCAACTTTTGACTATGG + Intronic
1052368657 9:27640875-27640897 GGAAACTGAATGTTTGACTATGG + Intergenic
1052442264 9:28512243-28512265 GGAAAATGAACATGTGACTATGG - Intronic
1052561520 9:30089717-30089739 AGAAACTGAATGTTTGACTGTGG - Intergenic
1052626927 9:30987219-30987241 GATATCTCAACATTTGACTATGG - Intergenic
1054961026 9:70969378-70969400 TGAAACTGCACATTTGACACAGG + Intronic
1055903934 9:81271165-81271187 GGAAACTGAACGTTTGACTATGG - Intergenic
1056156672 9:83845248-83845270 GGAAACTGAACGTTTGACTATGG + Intronic
1056314229 9:85372906-85372928 GGAAACTGAAAGTTTGACTATGG - Intergenic
1056353866 9:85778279-85778301 GGAAACTGAACGTTTGACTATGG - Intergenic
1058239802 9:102542532-102542554 AGAAGCTGAACATTTGACTATGG + Intergenic
1058259250 9:102809629-102809651 GGAAACTGAGCATTTGACTATGG - Intergenic
1058347986 9:103987272-103987294 ACAAACTGTACATTTGACAAAGG + Intergenic
1058392739 9:104514854-104514876 GCAAACTGTGCATTTGACAACGG + Intergenic
1058544162 9:106042711-106042733 AGAAACTGAGCATTTGACTATGG - Intergenic
1058582141 9:106469964-106469986 GCAAACTAAACATCTGACAAAGG - Intergenic
1059110502 9:111554786-111554808 GGAAAGTGAAACTTTGAATAAGG + Intronic
1059196500 9:112375829-112375851 GGAAACTGAACGTTTGACTATGG - Intergenic
1062135476 9:134925062-134925084 GGAAACTGAAAGTTTGACTATGG + Intergenic
1186279501 X:7977157-7977179 GGAAACTTAACCTTTACCTATGG + Intergenic
1186384089 X:9091723-9091745 AGAAATTGAATGTTTGACTATGG - Intronic
1186469762 X:9812070-9812092 AGAAACTGAACATTTGACTATGG - Intronic
1187518551 X:19993238-19993260 GGAAAATGATCATTTGCATAAGG - Intergenic
1187604871 X:20871901-20871923 AGAAACTAAATGTTTGACTATGG + Intergenic
1188077136 X:25791803-25791825 GGAAACTGTCCATCTGACAAGGG + Intergenic
1188139832 X:26535984-26536006 GGAAACTGAGCATTTTCTTATGG - Intergenic
1188267963 X:28101740-28101762 GGAAACTGACACTTTGACTTTGG - Intergenic
1189032433 X:37464241-37464263 GGAAACTGAATATTTGACTATGG - Intronic
1189154878 X:38746683-38746705 GGAAACTGAACGTTTGACTATGG - Intergenic
1190996743 X:55617444-55617466 GGAAAGTGAACATTTGACTCTGG - Intergenic
1191227543 X:58060050-58060072 GTAAGCTGCACATTTGACAAAGG - Intergenic
1191630032 X:63312550-63312572 GGAAACTGAATGTTTGACTATGG - Intergenic
1191658801 X:63629768-63629790 TGAAACTGAACGTTTGACTATGG - Intergenic
1191679579 X:63826981-63827003 GCAAACTATACATTTGACAAAGG - Intergenic
1191719235 X:64215671-64215693 GGAAACTGAACTTTTGACTCTGG - Intergenic
1191749461 X:64526239-64526261 GCAAACTCTACATTTGACAAAGG + Intergenic
1191759365 X:64629962-64629984 GGAAACTGAATGTTTGACTGTGG + Intergenic
1191946357 X:66539049-66539071 GGAAACTGTACGTTTGACTATGG + Intergenic
1192657631 X:73008934-73008956 AGAAACTGAACACTTGACCATGG - Intergenic
1192898709 X:75471947-75471969 GGAAACTGAACGATTGACTATGG + Intronic
1193053495 X:77125805-77125827 GGAAACTGAACATTTGACTATGG + Intergenic
1193297787 X:79852711-79852733 GGAAACTGATCGTTTTACTATGG + Intergenic
1193447161 X:81618808-81618830 GGAAACTGAACGTTTGACTATGG + Intergenic
1193512846 X:82426963-82426985 GCAAACTGTGCATTTGACAAAGG - Intergenic
1193777409 X:85660143-85660165 GCAAACTGTACATCTGACAAAGG + Intergenic
1193832953 X:86310134-86310156 GGAAACTGAATGTTTGACTATGG + Intronic
1193914797 X:87351891-87351913 AGAAACTGAATGTTTGACTATGG - Intergenic
1193957290 X:87878247-87878269 GGAAACTGAACGTTTGACTAAGG + Intergenic
1194137629 X:90166082-90166104 GCAAACTGCACATCTGACAAAGG + Intergenic
1194210281 X:91062391-91062413 GGAAACTGAACGTTTGACTATGG + Intergenic
1194343315 X:92731121-92731143 AGAAACTGAACGTTTGGATATGG + Intergenic
1194443555 X:93961140-93961162 GAAAACTGAACATTTGACTATGG + Intergenic
1194513413 X:94822215-94822237 GTAAACTGAATGCTTGACTATGG - Intergenic
1194521086 X:94919476-94919498 AGAAACAGAATGTTTGACTATGG + Intergenic
1194604384 X:95961931-95961953 GGAAACTGAATGTTTGACTATGG - Intergenic
1194626620 X:96233203-96233225 AGAACCTGAACATTTGACCATGG + Intergenic
1194635136 X:96336823-96336845 GCAAACTATACATTTGACAAAGG - Intergenic
1194833963 X:98658841-98658863 AGAAACTGAACGTTTGATTACGG + Intergenic
1194849241 X:98852137-98852159 GGAAACTGAGCGTTTGACTATGG - Intergenic
1194982853 X:100458271-100458293 GCAAACTGTGCATTTGACCAAGG + Intergenic
1195200294 X:102543329-102543351 GGTTAGTGAACATTTGATTAGGG + Intergenic
1195396734 X:104419087-104419109 GCAAACTAACCATTTGACAAAGG + Intergenic
1195776238 X:108409125-108409147 AGATACTGAACATTTCACTTAGG - Intronic
1195782347 X:108479828-108479850 GGAAACTGAACATTTGACTATGG - Intronic
1196135963 X:112209806-112209828 GGAAACTGAACATTTGGCTATGG - Intergenic
1196708044 X:118733231-118733253 GGAAATTTAAAATTTCACTATGG - Intronic
1197002295 X:121452961-121452983 GGAAACTGAACATTTGTCTATGG + Intergenic
1197245041 X:124158957-124158979 GGAAACTGAACGTTTGACTATGG - Intronic
1197372051 X:125637829-125637851 AGAAACTGAACATTTGACTGTGG - Intergenic
1197379995 X:125727868-125727890 GGAAACTGAACAATTGACTATGG - Intergenic
1197386767 X:125812206-125812228 GGAAACTGAACGTTTCACTAGGG - Intergenic
1197409320 X:126096378-126096400 GGAAATTGAACGTTTGACTATGG - Intergenic
1197477353 X:126941292-126941314 GGATGCTGAACGTTTGACTATGG - Intergenic
1197591871 X:128419424-128419446 GGAAAATGAACGTGTGTCTATGG + Intergenic
1198170006 X:134096291-134096313 AGAGACTGAACACTTGACCATGG + Intergenic
1198701306 X:139400333-139400355 GGAAACTGAAGGTTTGACTATGG + Intergenic
1198783033 X:140257760-140257782 GGAAACTGAAGGTTTGACTATGG - Intergenic
1199021254 X:142881138-142881160 GGAGACTGAATATTTAACCATGG + Intergenic
1199024384 X:142919756-142919778 GGAAACTGAACGTTTGACTATGG + Intergenic
1199040596 X:143111137-143111159 GGAAACTGAAGGTTAGACTATGG + Intergenic
1199310420 X:146314363-146314385 GGAAACCGAATGTTTGACTACGG - Intergenic
1199341541 X:146683402-146683424 GCAAACTGACCATCTGACAAGGG - Intergenic
1200340489 X:155390605-155390627 GGAAACTGAATGTTTGACTATGG - Intergenic
1200362539 X:155624608-155624630 GGAAACTGATCATTTTAAAAGGG - Intronic
1200483416 Y:3736343-3736365 GCAAACTGCACATCTGACAAAGG + Intergenic
1200521276 Y:4212067-4212089 GGAAACTGAATGTTTGACTATGG + Intergenic
1200651673 Y:5847786-5847808 AGAAACTGAACGTTTGGATATGG + Intergenic
1200746051 Y:6904835-6904857 GGAAACTGAACATTCAACTATGG - Intergenic
1200973118 Y:9177673-9177695 GAAAACTGAACTTTTGACTATGG - Intergenic
1200976633 Y:9218517-9218539 GGAAACTGAACGTTTGACTATGG + Intergenic
1202134538 Y:21648040-21648062 GGAAACTGAACGTTTGACTATGG - Intergenic
1202137960 Y:21686840-21686862 GAAAACTGAACGTTTGACTATGG + Intergenic