ID: 993203398

View in Genome Browser
Species Human (GRCh38)
Location 5:84847581-84847603
Sequence GAAACTGAACATTTGACTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 734
Summary {0: 60, 1: 133, 2: 160, 3: 122, 4: 259}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993203393_993203398 19 Left 993203393 5:84847539-84847561 CCTTTGGATAAATAGCTCTTGAC No data
Right 993203398 5:84847581-84847603 GAAACTGAACATTTGACTATGGG 0: 60
1: 133
2: 160
3: 122
4: 259
993203396_993203398 -3 Left 993203396 5:84847561-84847583 CCTGTTACTAAGCTTTGGTGGAA No data
Right 993203398 5:84847581-84847603 GAAACTGAACATTTGACTATGGG 0: 60
1: 133
2: 160
3: 122
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993203398 Original CRISPR GAAACTGAACATTTGACTAT GGG Intergenic
901904042 1:12392616-12392638 GAAAATGAACATCTGACTATGGG - Intronic
902998190 1:20243941-20243963 GTCACTCAACATTTGACTAGTGG + Intergenic
904179486 1:28655903-28655925 GAAACTGAACGTTTGACTATGGG - Intergenic
904335940 1:29798054-29798076 GAAACTGAATGTTTGACTATGGG + Intergenic
905465233 1:38148167-38148189 GAAATTGAACGTTTGACTATGGG + Intergenic
905605403 1:39294227-39294249 GAAATTTAACATTGGACAATAGG + Intronic
906050497 1:42867482-42867504 GAAACTGAACATTTGACTATGGG + Intergenic
906054924 1:42908085-42908107 GAAACTAAACACCTGACCATAGG - Intergenic
906879682 1:49576531-49576553 GAAACTGAAAGTTTGACTATGGG + Intronic
907184123 1:52596128-52596150 GAAACATAACAATTGACTCTAGG - Intergenic
907595748 1:55718379-55718401 GATATTGAACATTTAACCATGGG - Intergenic
907597349 1:55732198-55732220 GAAACTGAGCATTTGACTATGGG + Intergenic
907637419 1:56150034-56150056 AAAACTGAGCACTTGACTGTTGG - Intergenic
907720643 1:56968852-56968874 GAAACTGATCATATGTCTCTAGG + Intergenic
907780350 1:57560902-57560924 GAAACTGAACGTTTGACTACGGG + Intronic
908271836 1:62429956-62429978 GAAACTAAGGAATTGACTATTGG + Intergenic
908299191 1:62745200-62745222 GGAACTTAACATCTGACTCTTGG + Intergenic
908737396 1:67290881-67290903 GAAACTGAACGTTTGACTATGGG + Intergenic
909172600 1:72315398-72315420 GAAACTGAATGTTTGACTATGGG - Intergenic
909278739 1:73722191-73722213 GAAACTGAGCACTTGACTATGGG + Intergenic
909548940 1:76877115-76877137 GAAACTGATCATTTGGCTATGGG - Intronic
909810963 1:79931405-79931427 GAAGCTGAATATTTGGCTATGGG + Intergenic
910141294 1:84030057-84030079 GAGACTGAATACTTAACTATGGG + Intergenic
910370643 1:86512196-86512218 GAAACTGAATATTTGACTATGGG + Intergenic
910561907 1:88600049-88600071 AAAACTGAACGTTTGACTATGGG + Intergenic
910630231 1:89346320-89346342 GAAACTGAACATTGGACTATGGG + Intergenic
910638983 1:89439906-89439928 GAAAATGAACCTTTGACTATGGG - Intergenic
910790330 1:91043788-91043810 GAAAATGAACCTTTGACTATGGG + Intergenic
910831089 1:91463356-91463378 GAAACTGAATGTTTGACTATGGG - Intergenic
911109089 1:94164137-94164159 GAAACTGAATATTTGACTATGGG - Intronic
911257316 1:95647296-95647318 GAAACTGAACATTTGACTATGGG - Intergenic
911352456 1:96771037-96771059 GAAAAAGAACATTTGACCAGGGG - Intronic
911738389 1:101361851-101361873 GAAACTGAACTTTTGACTACGGG - Intergenic
911894280 1:103410811-103410833 GAGATTGAATATTTGAGTATCGG - Intergenic
911980434 1:104559489-104559511 GAAACTGAATGTTTGACTGTGGG + Intergenic
911981891 1:104579194-104579216 GAAACTGAATGTTTGACTATGGG - Intergenic
912050670 1:105524880-105524902 GAAACTGAACGTGTGACTATGGG - Intergenic
912067033 1:105757023-105757045 GAAACTGAATGTTTGACTATGGG + Intergenic
912129905 1:106587982-106588004 GAAACTAAACGTTTGACTATGGG - Intergenic
912140148 1:106714837-106714859 GAAACAGAAAAATTAACTATTGG - Intergenic
912212260 1:107568962-107568984 GAAACTGAACATTTGACTATGGG + Intergenic
912252021 1:108021320-108021342 GAAACTGAACGTTTGACTGTGGG - Intergenic
912671668 1:111634072-111634094 GACACTGAACATGTGGTTATGGG - Intronic
912733314 1:112128761-112128783 GAAACTGAACATTTGATTATGGG - Intergenic
912943805 1:114068136-114068158 GAAACTGAACATTTGACTACAGG - Intergenic
913039438 1:115008327-115008349 GAAACTGAACATTTGACTACGGG - Intergenic
913231567 1:116744598-116744620 AAAACTGAAGATTTGAGAATAGG - Intergenic
914517348 1:148385212-148385234 GAGACTGAGCCTGTGACTATAGG + Intergenic
915667663 1:157459575-157459597 GAAACTAAACATTTGACTATGGG - Intergenic
915715031 1:157937412-157937434 GAGACTGAACCCTTGACCATGGG + Intergenic
916106321 1:161435259-161435281 GAAACTGAACGTTTGAGTGTGGG - Intergenic
916285325 1:163099596-163099618 GAAACCGAACATTTGACTATGGG + Intergenic
917151063 1:171945357-171945379 GAAACAGAACAGTTAACCATTGG + Intronic
917217206 1:172690845-172690867 GATACTGAACGTTTAGCTATGGG - Intergenic
918755704 1:188337741-188337763 GAAACTGAATATTTGACTATGGG - Intergenic
918815086 1:189171296-189171318 GAAACTGAATGTTTGACTGTGGG + Intergenic
918918222 1:190671811-190671833 GAAAATGAACGTTTGACTATGGG - Intergenic
919019573 1:192086887-192086909 GAAAGTGAACACATGACTGTAGG + Intergenic
919124608 1:193379713-193379735 GTAACTGAACGTTTGACTAAGGG - Intergenic
919241780 1:194924272-194924294 AAAACTGAACGTTTGACTATGGG + Intergenic
919275987 1:195417278-195417300 GAAAATGACCATGTGACAATGGG - Intergenic
919283341 1:195519676-195519698 GAAATTGAACATTTCACTACAGG + Intergenic
919317979 1:195999430-195999452 GAAACTAAATGTTTGACTATGGG + Intergenic
919463027 1:197901687-197901709 GAAAATGAAAATATGACTACAGG + Intergenic
920197439 1:204238434-204238456 GAAACTGAACGTTTGACTATGGG + Intronic
920417657 1:205809652-205809674 GAAACTGAGCTTTCTACTATGGG + Intronic
920714487 1:208326844-208326866 GAAACTGTTCATCTGAATATAGG - Intergenic
921165612 1:212504713-212504735 GATACAGAACATTTGGCTAATGG + Intergenic
921431223 1:215068440-215068462 GAATCTGAACAATGCACTATTGG + Intronic
922198344 1:223379639-223379661 GAAACGGAAAACATGACTATAGG - Intergenic
923253561 1:232199369-232199391 GAAACTGAACGTTTGACTATGGG - Intergenic
1064517633 10:16168188-16168210 GAAACTGAACATTTGACTATGGG - Intergenic
1064545681 10:16448067-16448089 GAAACTGAACGTTTAACTATGGG - Intronic
1065005334 10:21374232-21374254 GAAACTGAACGTTTGATTATGGG + Intergenic
1066144203 10:32540022-32540044 TAAACTCAACACTTGACTAGTGG - Intronic
1066167020 10:32799162-32799184 GAAACTAAACATTTGACTATGGG - Intronic
1066169435 10:32826386-32826408 GAAACTGAACATTTGACTATGGG + Intronic
1066505407 10:36037385-36037407 GAAACAAGACATTTGACCATAGG + Intergenic
1067125544 10:43512476-43512498 GAAACTGAAGGTTTGACTATGGG - Intergenic
1067333145 10:45340285-45340307 GAAACTGAACATTTGATTATGGG + Intergenic
1067754344 10:48993651-48993673 GAAACTGAACGTTTGACTATGGG - Intergenic
1067968804 10:50945062-50945084 GAAACTAAACAGATGACTTTCGG - Intergenic
1068007665 10:51409502-51409524 GAAACTAAATGTTAGACTATGGG - Intronic
1069019271 10:63466962-63466984 GAAACTGAAATTTAGAATATTGG - Intergenic
1069145768 10:64890508-64890530 GAAACTGAATGCTTAACTATAGG + Intergenic
1069192296 10:65506302-65506324 CAAATTGAACGTTTGACTATGGG - Intergenic
1069218435 10:65852523-65852545 GAAACTGAACATTTTATAACTGG + Intergenic
1069790821 10:71019515-71019537 GAAACTGAACGTTTGACTATGGG - Intergenic
1071267076 10:83973934-83973956 GAAACTGAACATTTGACTATGGG - Intergenic
1071378390 10:85033425-85033447 GAAACTGAACGTTTGACTAGGGG + Intergenic
1071619784 10:87108767-87108789 GAAACTGAACATTTACCAAAAGG - Intronic
1071937697 10:90549344-90549366 GAAACTGAACATTTGACCATGGG + Intergenic
1071942774 10:90607710-90607732 GAAACTGAACATTTAACTATGGG - Intergenic
1071947080 10:90657663-90657685 GAAACTGAACACTTGACCATGGG - Intergenic
1072360475 10:94654211-94654233 GAAACTGAACGTTTGACTATGGG + Intergenic
1073557355 10:104465968-104465990 GAAACTGAACATTTGACTATAGG + Intergenic
1073607091 10:104907451-104907473 GAAACTGAAGATCTGAATATTGG + Intronic
1073687079 10:105766501-105766523 GAAAGGGAACAAGTGACTATTGG - Intergenic
1073918468 10:108432247-108432269 GAAACTGAATGTTTGACTATGGG - Intergenic
1073995866 10:109314649-109314671 GAAACTGAACATTTGACTATGGG - Intergenic
1074616057 10:115069328-115069350 GAACCTGAACATTTCCCTTTAGG + Intergenic
1074632508 10:115273982-115274004 GAAACTGAATGTTTAACCATGGG - Intronic
1075606796 10:123817467-123817489 TAAACTGAACATTTGTCTATGGG + Intronic
1076772621 10:132674771-132674793 GAAACTGAACGTTTGTCTATGGG - Intronic
1076927409 10:133499158-133499180 GAAACTGAACGTTTGACTGTAGG - Intergenic
1077381086 11:2237971-2237993 GAAACTGAATGTTTGACCATGGG + Intergenic
1077396535 11:2326420-2326442 GAAACTAAACACTTGACCAAGGG + Intergenic
1077669472 11:4144633-4144655 GAGACTGAACACTTAACCATGGG + Intergenic
1077735456 11:4786050-4786072 GAAACTGAACAAGTCTCTATGGG + Intronic
1079992625 11:27262478-27262500 GAGACTCAACTTTTGACTAGAGG - Intergenic
1080162436 11:29193022-29193044 GATACTGTAAAATTGACTATTGG + Intergenic
1080162629 11:29196215-29196237 GCAACTGAACATATAACTTTTGG - Intergenic
1080336448 11:31202935-31202957 GAAATAGAACATGTGACTGTTGG + Intronic
1081065454 11:38534834-38534856 GAAACTGAATGTCTGACTATGGG - Intergenic
1081072784 11:38631163-38631185 GAAACTGAACATTTGACCATGGG + Intergenic
1081110483 11:39128461-39128483 GAAACTGAACATTTGACCATGGG + Intergenic
1081419812 11:42862626-42862648 GAAACTGATCATCTAATTATAGG - Intergenic
1081609068 11:44547920-44547942 GAAACTGAAACTTTGACTATGGG + Intergenic
1082999667 11:59279921-59279943 AAAACTGAACGTTTGACTGAGGG + Intergenic
1083093153 11:60221169-60221191 GAAACTAAACGGTTGGCTATGGG + Intronic
1083698041 11:64455693-64455715 GAAACTGAGCATCTGACCAGGGG + Intergenic
1084987408 11:72888145-72888167 GAAACTGAATATTTCATTGTGGG + Intronic
1085685969 11:78622232-78622254 GAAACTGAACGTTTGATTATGGG + Intergenic
1085747578 11:79128282-79128304 GAAACTGAACATTTGACTATGGG + Intronic
1086141628 11:83506142-83506164 GAAACTGAACGTTTGACTACGGG - Intronic
1086278618 11:85160494-85160516 GAAACTGAACGTTTGACTATAGG + Intronic
1086667640 11:89503186-89503208 GCAACTGAAAATTTGGCTATGGG - Intergenic
1087530410 11:99374172-99374194 GAAATTGGACCTCTGACTATTGG - Intronic
1088097211 11:106115200-106115222 GAAACTGAACGTTTGACTATGGG + Intergenic
1088191653 11:107234448-107234470 GAAACTGAACATTTGACTATGGG - Intergenic
1088265424 11:107983653-107983675 GAAACTGAACATTTGACTATGGG + Intergenic
1088407605 11:109498620-109498642 GAAACTGAACGTTTGACTATGGG - Intergenic
1088449362 11:109965410-109965432 GAAACTGAATGTTTGACTACGGG + Intergenic
1088836663 11:113583431-113583453 GAAACTGAACATTTGACTGTGGG + Intergenic
1089903613 11:122013651-122013673 GAAACCGAATGCTTGACTATGGG + Intergenic
1090179150 11:124678902-124678924 AAAACTTAACATTTGCCTTTAGG + Intronic
1090753980 11:129772544-129772566 GAGACTGAATGTTTGACCATGGG - Intergenic
1091051745 11:132378798-132378820 GAACCTGAACGTTTGACTATGGG + Intergenic
1091103478 11:132897302-132897324 GAAACTGAACGCTTGACCATGGG + Intronic
1091510211 12:1115645-1115667 AAAACTGGACATTTCCCTATTGG + Intronic
1091843589 12:3637856-3637878 GAAACTGAACATTTGAACAAAGG - Intronic
1092093289 12:5821693-5821715 GAAACTGAACGTTTGACTATGGG + Intronic
1092381566 12:8000981-8001003 GAAACTGAACGTTTGACTATGGG + Intergenic
1093031863 12:14295907-14295929 GAAACAGAACGTTTGACTATGGG - Intergenic
1093036344 12:14335726-14335748 GAAACTGAATGTTTGATGATGGG + Intergenic
1093048916 12:14484924-14484946 GAAACTGAACATTTGACTATGGG - Intronic
1093049662 12:14490919-14490941 GAAACTGAACATTTGACTATGGG - Intronic
1093339807 12:17959862-17959884 GAAAATGAATGTTTCACTATTGG + Intergenic
1094102537 12:26779305-26779327 GAAACTGAACATTTAACTATGGG + Intronic
1095121499 12:38424801-38424823 GAAACTGAATGTTTGAGTATGGG - Intergenic
1095190270 12:39250207-39250229 GAGACTGAACACTTAACCATGGG + Intergenic
1095844386 12:46729925-46729947 GAAATTGGACATTTGGCCATGGG - Intergenic
1096288719 12:50323003-50323025 GAAACTGAACATTTGACTATGGG + Intergenic
1096457459 12:51799394-51799416 GAAACTGAACGTTTGACCATGGG - Intronic
1097077005 12:56402484-56402506 GAAACTGAACGTTTGACTATAGG + Intergenic
1097437832 12:59572211-59572233 GAAACTGAATGTTTGACTGTAGG - Intergenic
1097495790 12:60331304-60331326 GAAACAGAAAAAATGACTATTGG + Intergenic
1097821334 12:64131821-64131843 GAAACTGAACGTTTGACCATGGG - Intronic
1097843350 12:64342718-64342740 GAAACTGAACGTTTGACCATGGG - Intronic
1098673047 12:73254287-73254309 GAAATTGAACATTTGACAATGGG + Intergenic
1098716098 12:73829858-73829880 GAAACTGAACATTTGACTATGGG + Intergenic
1098731057 12:74037391-74037413 AAAACTGAACATTTGACTATGGG + Intergenic
1098733298 12:74065674-74065696 GAAACTGAACGTTTGACTGTGGG + Intergenic
1098805379 12:75015555-75015577 GAAACTGAACGTTTGACTATGGG + Intergenic
1098831900 12:75373982-75374004 GAAACTGAACGTTTGACTGTGGG - Intronic
1099183372 12:79492545-79492567 GAAACTGAACATTTGACTATGGG - Intergenic
1099365931 12:81765427-81765449 GAAACTGAATGTTTGACTATGGG + Intergenic
1099375654 12:81894000-81894022 GAAAGTGAATGTTTGACTATGGG + Intergenic
1099379375 12:81936497-81936519 GAAACTGAACATTTGATTATGGG - Intergenic
1099508567 12:83507230-83507252 GAAACAGAACGTTTGACCATGGG + Intergenic
1099526369 12:83723154-83723176 GAAACTGAACATTTGACTATGGG + Intergenic
1099578082 12:84405434-84405456 GAAGCTGAACATTTGAGTATGGG + Intergenic
1099689786 12:85938080-85938102 GAAACTGAACCTTTGACTATGGG + Intergenic
1099735788 12:86565082-86565104 GAAACTGAACATATGAATATGGG + Intronic
1099804423 12:87499590-87499612 GAAACTGAACACTTGCCTATAGG - Intergenic
1099821346 12:87715054-87715076 GAAACTGAACACTTAACCATGGG - Intergenic
1100041325 12:90321637-90321659 GACAGAGAACATTTTACTATGGG - Intergenic
1100083310 12:90878255-90878277 AAAACTGGCCATTTGAATATGGG + Intergenic
1100231956 12:92617897-92617919 GAAACTGAACACTTGACCAGGGG + Intergenic
1100241145 12:92711565-92711587 GAAACTGAACATTTGACTATGGG - Intergenic
1101264138 12:103066165-103066187 GAAACTGAACGTTTGCCTATGGG + Intergenic
1101534660 12:105606061-105606083 GAAATTGGACATTTGACAATGGG - Intergenic
1101543078 12:105682679-105682701 GAAATTGAACGTTTGACAATGGG + Intergenic
1102283601 12:111637407-111637429 AAACCTGAACTTTTGCCTATTGG + Intergenic
1103035618 12:117654106-117654128 GAAACTGTACATTTGGCTATGGG + Intronic
1103396533 12:120611490-120611512 GAAACTGAACATTTGACGATGGG + Intergenic
1103428130 12:120856558-120856580 GAAAATAAAAATTTAACTATGGG + Intronic
1105523755 13:21155391-21155413 AAAAATTAACATTTGAATATTGG - Intronic
1105740117 13:23315219-23315241 GAAACTGGAAGTTTGACTGTGGG + Intronic
1106054787 13:26228134-26228156 GAAACTGAGCATCTGACCATGGG - Intergenic
1106897009 13:34314261-34314283 GAAAAGAAAAATTTGACTATTGG - Intergenic
1107942135 13:45384069-45384091 AAAACTGGACATTTGATTTTGGG - Intergenic
1107983569 13:45755929-45755951 GAAACTGAACGTTTGACTATGGG - Intergenic
1108302426 13:49091942-49091964 GAAACTGAATATTTGACTATGGG - Intronic
1108904283 13:55450014-55450036 GAAATGGAACATTTAACTATAGG + Intergenic
1108914297 13:55588828-55588850 TAAACTGAACGTTTGACTATGGG - Intergenic
1109293231 13:60500161-60500183 GAAACCGAACATTTGACTATGGG + Intronic
1109392321 13:61709028-61709050 GAAACTGAAAGATTGACCATGGG + Intergenic
1109519028 13:63484844-63484866 GAAACTGAACGTTTGACTATGGG + Intergenic
1109583055 13:64366210-64366232 GAAACTGAACATTTGACTATGGG + Intergenic
1109712676 13:66180779-66180801 GAAACTGAACGTTTGACTGTGGG - Intergenic
1109933286 13:69245132-69245154 GAAACCAAACACTTGACCATGGG - Intergenic
1110194954 13:72778101-72778123 TAAAGTGAACATCTGACTATAGG + Intronic
1110377178 13:74806512-74806534 GAAACTGAACGCTTGACTATGGG + Intergenic
1110834128 13:80064586-80064608 GAGACTGAACGTTTGACTATGGG - Intergenic
1111044407 13:82796026-82796048 GAAACTAAATATTTGACTATGGG + Intergenic
1111057793 13:82972984-82973006 GAAACTGAACATTTGACTATGGG - Intergenic
1111262952 13:85766738-85766760 GAAACTGAATATCTGAGTTTGGG + Intergenic
1111517675 13:89356668-89356690 GAATCTGAAGATTTGAATAGGGG + Intergenic
1112231122 13:97590121-97590143 GAAACTGAAAGCTTGACTGTGGG - Intergenic
1112249922 13:97770235-97770257 GAAACTGAATATTTGACTATGGG - Intergenic
1112585320 13:100713903-100713925 AAAACTGAAGATTTCACTTTTGG - Intergenic
1113319699 13:109221620-109221642 GAAACTGAATGTTTGACTATGGG - Intergenic
1114205877 14:20570812-20570834 GAAACTGAAAGTTTGACTATGGG + Intergenic
1114679362 14:24471859-24471881 GACACTGAATATCTGACCATGGG - Intergenic
1114758251 14:25283833-25283855 GAAACTGAACGTTTGACTATGGG - Intergenic
1115059722 14:29173937-29173959 GAAACTGAACGTTTGACTATGGG + Intergenic
1115130699 14:30049303-30049325 GTAATTGAACGTTTGACTATGGG + Intronic
1115448664 14:33520772-33520794 GAAACTGACCATTTTATTACAGG - Intronic
1115783186 14:36793889-36793911 CAAAATGAACATTTCACTCTAGG - Intronic
1116058914 14:39896981-39897003 GAAACTGAGTGTTTGACTATGGG + Intergenic
1116308038 14:43283404-43283426 GAAACTGAACATTTGACTATGGG - Intergenic
1116415078 14:44669353-44669375 GAAACCGAATGTTTGACTACGGG + Intergenic
1116531451 14:45978182-45978204 GAAACTGAATGTTTGACTATGGG - Intergenic
1117026993 14:51630956-51630978 GAAACTGCCAATTTGACTCTTGG - Intronic
1117634140 14:57724416-57724438 GAAACTGAACGTTTGACTATGGG + Intronic
1118088195 14:62442463-62442485 TAAACTGATTATTTGAATATTGG + Intergenic
1118122427 14:62860127-62860149 GAAACTGAACATTTGACTATGGG - Intronic
1118385497 14:65252502-65252524 GAGACTGAATGTTTGACCATGGG - Intergenic
1118880767 14:69823975-69823997 GAAACCGAACGTTTGACTATGGG - Intergenic
1119059692 14:71462147-71462169 GAAACTGAACATTTGACTATGGG - Intronic
1120082016 14:80227487-80227509 GAAACTGAATGTTTGACTATGGG - Intronic
1120231418 14:81845208-81845230 GAAACTAAATGTTTGACTATGGG - Intergenic
1120555985 14:85930395-85930417 GAAACTGAATGTTTAACTATGGG - Intergenic
1120803367 14:88718134-88718156 CAAACTGATCATCTGTCTATGGG - Intronic
1120973709 14:90230869-90230891 GAAACTGAACATTTGACTATGGG + Intergenic
1123149298 14:106165936-106165958 TAAACTGAAAATTTGAGGATAGG + Intergenic
1124571706 15:30870397-30870419 GAGACTAAACATTTAACCATGGG + Intergenic
1124703352 15:31936858-31936880 GAAACTGAATGCTTGACCATGGG + Intergenic
1125982019 15:44011049-44011071 GAGACAGAACATTTGGCTAGTGG + Intronic
1126283617 15:46986320-46986342 GAAACTGAAAATTTGTCTATGGG + Intergenic
1127457605 15:59169224-59169246 GAGATTGACCAGTTGACTATTGG - Intronic
1127725526 15:61745525-61745547 TAAACTGAACTTTGGAGTATAGG - Intergenic
1130730695 15:86488844-86488866 AAGAATGAATATTTGACTATAGG - Intronic
1131908860 15:97173753-97173775 TAACCTGGACATTTTACTATAGG - Intergenic
1131990387 15:98087843-98087865 TAAAATGAAAATTTCACTATAGG + Intergenic
1134674582 16:16080808-16080830 GCAACTGCACATTTGTCTCTTGG + Intronic
1135061632 16:19275963-19275985 GAAACTGAACGCTTGACTATGGG - Intergenic
1135626011 16:23995539-23995561 GAAACTGACGATTTGACCATGGG + Intronic
1136250947 16:29004634-29004656 GAAACTGAATGTTTGACTATGGG + Intergenic
1137312811 16:47282982-47283004 CAAACTGAACATCTGACAAAGGG - Intronic
1138276197 16:55736701-55736723 GAACCAGAACATTCCACTATCGG + Intergenic
1138868391 16:60850825-60850847 GAAACTGAGTGTTTGACTATGGG + Intergenic
1141453742 16:84124250-84124272 GAAATTGACCATTTCACTAGAGG - Exonic
1141559536 16:84857995-84858017 GAAACTGAACGTTTGACTATGGG - Intronic
1143050110 17:4118319-4118341 GAAACTGAACATTGGACTATGGG - Intronic
1145071354 17:19811200-19811222 GACAATGAATATTTGTCTATAGG + Intronic
1145412120 17:22676372-22676394 GATATTCAACATTTCACTATAGG + Intergenic
1146020469 17:29273892-29273914 AAAACTGGACATTTCGCTATAGG - Intronic
1146836362 17:36114043-36114065 GAAACTGAACGTTTGACTATGGG + Intergenic
1146850940 17:36221083-36221105 GAAACTGAACGTTTGACTATGGG + Intronic
1149241572 17:54656846-54656868 GAAAGTGAAGATTTGACTCTGGG + Intergenic
1149289504 17:55202937-55202959 GAAAACGATCATTGGACTATAGG + Intergenic
1151037804 17:70821555-70821577 GAAACTGAACATTTGACTATGGG - Intergenic
1151369935 17:73641524-73641546 GAAAGCTAACATTTGACCATTGG - Intronic
1153089716 18:1330201-1330223 GAAACTGAACGTTTGACTATGGG + Intergenic
1153184399 18:2470785-2470807 GAGAGTGAACACTTGACCATGGG + Intergenic
1153955927 18:10096293-10096315 AAGACTGAACACTTGACCATAGG + Intergenic
1154068469 18:11131137-11131159 GAAACTGAATGTTTGACTATCGG + Intronic
1154252665 18:12757236-12757258 GAAACTTAATGTTTGACTATGGG - Intergenic
1155940761 18:31799956-31799978 GAAACTGAATGTTTCACTATGGG + Intergenic
1156146360 18:34185445-34185467 GAAACTGAATTTTTTACAATGGG + Intronic
1156159944 18:34347348-34347370 GAGACTGAACATTTGACCACAGG - Intergenic
1156196868 18:34784218-34784240 GAAATTAAACATTTAACTTTAGG + Intronic
1156288687 18:35724689-35724711 GGAACTGAAAAATTGACTACAGG + Intergenic
1156303868 18:35858733-35858755 GAAACTGGACATTTGACTGTGGG + Intergenic
1156582557 18:38394503-38394525 GAAACTGAACATTTGACTATGGG + Intergenic
1156990297 18:43400736-43400758 GAAATTGAATGTTTGACTATGGG - Intergenic
1156998585 18:43497768-43497790 GAAACTGAACATCTGACTATGGG + Intergenic
1157341209 18:46780066-46780088 GAAACTGAACGTTTGACTACGGG + Intergenic
1157998499 18:52588085-52588107 GAAACTGAACGTTTGACTATGGG - Intronic
1159559099 18:69975312-69975334 GAAACTGAACATTTGACTATGGG - Intergenic
1159711304 18:71764163-71764185 GAAACTGAACGTTTGACTATGGG + Intronic
1160092469 18:75840054-75840076 GAAACTGAATGTCTGACTATAGG + Intergenic
1164097080 19:22021304-22021326 AAAACTGAACTTTTGACTATGGG - Intergenic
1165560105 19:36671750-36671772 GAGACTGAACATTTAATCATGGG + Intergenic
1167951588 19:53031965-53031987 GAAACTGAATATTTGACTATGGG + Intergenic
925460732 2:4060485-4060507 GAAACTGAATGTTTGACTATGGG + Intergenic
925503134 2:4529394-4529416 GAAACTCAACATCTGAATGTCGG - Intergenic
926810388 2:16750637-16750659 GAAACTGAATGTTGGACTATGGG - Intergenic
926818161 2:16822007-16822029 GAACTTGAACATTTAATTATTGG + Intergenic
927008725 2:18879763-18879785 GAAACTGAATGTTGGACTATGGG + Intergenic
928007714 2:27578667-27578689 GAAACTGAGGATTTGAATCTAGG + Exonic
929269820 2:39960742-39960764 GAAACTGAACGTTTGATTATGGG - Intergenic
930298990 2:49592041-49592063 AAAACTGAACAGTGGGCTATAGG - Intergenic
930910157 2:56620938-56620960 GAAACTGAACATTTGACTATGGG + Intergenic
932425642 2:71632881-71632903 GGACCTGATCACTTGACTATTGG - Intronic
932870699 2:75395042-75395064 GAAACTGAATGTTTGAATATGGG - Intergenic
933265681 2:80178341-80178363 GAAACTGAACGTTCAACTATAGG - Intronic
933394458 2:81713316-81713338 AAAACTAAACGTTTGACTATGGG - Intergenic
934720254 2:96569678-96569700 TAAAATGAACATTTGTGTATTGG + Intergenic
934819085 2:97356407-97356429 GAAACTTAACCTAAGACTATAGG + Intergenic
935183942 2:100714940-100714962 GAAACTGAATGTTTGACTATGGG + Intergenic
936641231 2:114314731-114314753 AAAACTGAATGTTTGACTATGGG + Intergenic
936646281 2:114376341-114376363 AAAACTGAACACTTGATCATGGG - Intergenic
937531197 2:122829646-122829668 GAGACTGAATACTTAACTATGGG + Intergenic
937582057 2:123499126-123499148 GAAACTGAAAGTTTGACTATGGG - Intergenic
937785200 2:125887687-125887709 GAAACTGAACATTTGACTATGGG - Intergenic
937800330 2:126074769-126074791 GAAACAGAATGTTTGACGATGGG + Intergenic
937852563 2:126648697-126648719 GAAACTGAATGTTTGACTATGGG - Intergenic
938241986 2:129749375-129749397 GGAAATGAAAATTTCACTATAGG + Intergenic
938799234 2:134745489-134745511 AAAGATGAACATTAGACTATAGG - Intergenic
939069069 2:137517897-137517919 GAAACTGAATGTTTGACTGTGGG + Intronic
939126054 2:138178843-138178865 GAAACAGAACTTTAGCCTATAGG + Intergenic
940171308 2:150832671-150832693 GAAACTGAACATTTGACTACAGG - Intergenic
940472083 2:154113086-154113108 GAAACTGAATGTTTGCCTACGGG - Intronic
940736830 2:157463271-157463293 GAAACTAAACTTTTGACTAAAGG - Intronic
941000916 2:160203118-160203140 GAAACTGAACCTTTTATAATGGG - Intronic
941330662 2:164174524-164174546 TAAACTGAACACTTGACTATGGG - Intergenic
941595522 2:167472138-167472160 GAATCTGCACATCTGACTGTAGG + Intergenic
942321948 2:174743575-174743597 GAAACTGAATGCTTGACCATGGG + Intergenic
942714590 2:178877365-178877387 GAAACTGCTCATTTGATTGTTGG - Intronic
942896044 2:181055693-181055715 CAAAGTGTACATTTAACTATAGG - Intronic
943006901 2:182395882-182395904 GAAACTGAACTTTTGACTAGTGG + Intronic
943239212 2:185362531-185362553 GAAACTGAACATTTGACTACGGG - Intergenic
943384057 2:187181049-187181071 GAAACAGAATGTTTGACTATGGG - Intergenic
943789224 2:191912951-191912973 GAGAATGAACTTTTGACTCTGGG + Intergenic
944494119 2:200289159-200289181 GGATCTGAACATGTGTCTATAGG - Intergenic
944931103 2:204520561-204520583 ACAACTGAACATTTCAGTATAGG - Intergenic
945202627 2:207298151-207298173 TAAAATGAACATTTCACTAGAGG + Intergenic
945462777 2:210130012-210130034 GAAACTGAAGATATAACTGTAGG + Intronic
945642183 2:212443878-212443900 GAAACTGAACATTTGACCATAGG + Intronic
945717829 2:213380629-213380651 GAAACTGAATGTTTGACTATGGG - Intronic
945725839 2:213471454-213471476 GAAACTGAACGTTTGACTATGGG - Intronic
946463378 2:219889966-219889988 GCTACTGAACATCTGGCTATGGG - Intergenic
946527860 2:220539926-220539948 GAAACTGAACATTTGACTATGGG - Intergenic
946703768 2:222437751-222437773 GAAACTGAAGATTTGACTATGGG - Intronic
946790927 2:223299801-223299823 GAAACTGAACTTTTGACTATGGG + Intergenic
947766076 2:232638363-232638385 GAAGAGGAACATTTGGCTATGGG + Intronic
947891362 2:233624073-233624095 GAAACATAACATTTAACAATGGG - Intronic
948511008 2:238465304-238465326 GAAACTGACCATTAGAATATGGG - Intergenic
1170092305 20:12604078-12604100 GAAAATGAACACTTGACCATGGG - Intergenic
1170230502 20:14042094-14042116 GAAACTGAACTTTTTAGTATTGG + Intronic
1170242895 20:14189933-14189955 GAAATTGAACATGTGACTGTTGG + Intronic
1170456686 20:16540333-16540355 GAAAATAAACATTTCACTGTTGG + Intronic
1174376988 20:50132888-50132910 GACACTGAACACATGTCTATGGG + Intronic
1176998167 21:15580225-15580247 GAAACTGAACATTTGACTATGGG + Intergenic
1177139409 21:17342228-17342250 GAAACTGAACATTTGACTATGGG - Intergenic
1177278288 21:18945167-18945189 GAAAATGAACATTTCAGGATTGG - Intergenic
1177505554 21:22014141-22014163 GAAACTGAACGTTTGACTATGGG - Intergenic
1177933691 21:27316891-27316913 GAAACTGTATATTTGACTGTGGG - Intergenic
1178012666 21:28305216-28305238 GAAACTGAACGTTTGACTATGGG + Intergenic
1178060749 21:28851097-28851119 GAAACTGAATGTTAGATTATGGG - Intergenic
1179295894 21:40062106-40062128 AAAACTGAACATTTGAAGAGGGG + Intronic
1179383533 21:40921091-40921113 GAAACTAAACACTTTACCATGGG + Intergenic
1180591141 22:16938326-16938348 GAAACTGATCATTTGACTATGGG - Intergenic
1182290263 22:29272011-29272033 TAAACTCAACATTTGACTGTGGG - Intronic
1182450468 22:30417405-30417427 GAAACTGGAGATTTGATTGTGGG - Intronic
1183819696 22:40335920-40335942 GAAATTCAACATTTGAATTTGGG + Intergenic
1184603554 22:45558334-45558356 GAAACTGAATGTTTGACTCTGGG - Intronic
949125658 3:443105-443127 GAAACTGAATGTTTGCCTACGGG - Intergenic
949192614 3:1268119-1268141 GAAAATGAACATTTGCCAAAAGG + Intronic
949245874 3:1924963-1924985 GAAACTGAACGTTTGACTATGGG + Intergenic
949417586 3:3830842-3830864 GAAACTGAACGTTTGACCATGGG - Intronic
949638786 3:6012557-6012579 GAAACTGAACATTTGACTATGGG + Intergenic
951003624 3:17592892-17592914 GAAACTGAATGTTTGACTATGGG + Intronic
951122578 3:18945607-18945629 GAAACTGAATGTTTGACTACGGG + Intergenic
951291513 3:20876705-20876727 GAAACTGAACGTTTGACTAGAGG - Intergenic
952177834 3:30885946-30885968 GAATATGAATATTTTACTATTGG + Intronic
952605436 3:35141975-35141997 GAAACTGAACATTTGGCTATGGG - Intergenic
954054162 3:48008000-48008022 GAAATTGAATGTTTGACTATGGG + Intronic
954511484 3:51129621-51129643 GAAACTGAACGTTTGACTATGGG - Intronic
955035591 3:55264132-55264154 GAAACTGAACATTTGACTATGGG + Intergenic
955131344 3:56172127-56172149 GAAACTGAACATTCTACACTGGG - Intronic
956306882 3:67835662-67835684 GAAATTGAACATTTGACCAAGGG + Intergenic
956360459 3:68441478-68441500 GAAACTGAACGTTTAACTATGGG + Intronic
957247577 3:77733857-77733879 GAAACTGAACATTTGACTATGGG - Intergenic
957616320 3:82532496-82532518 GAAACATAACATTTGAATAAAGG + Intergenic
957754604 3:84469466-84469488 GAAACTGAATGTTTGACTATGGG + Intergenic
958438893 3:94131424-94131446 GAAACTGAACAATGGAAAATAGG - Intergenic
958487671 3:94732434-94732456 GAAACTGAACGTTTGACTATGGG - Intergenic
958845682 3:99261705-99261727 GAAACTGAACATTTGACTACAGG - Intergenic
958934309 3:100240668-100240690 GAAACTGAACGTTTGACTATGGG + Intergenic
959203644 3:103279205-103279227 GAAACTGAACGTTTGACTATGGG - Intergenic
959439515 3:106359222-106359244 GAAACCGAACTTTTGACTATAGG + Intergenic
959746008 3:109777233-109777255 GAAAATGAACATTTGACTATGGG - Intergenic
959997866 3:112698360-112698382 GAAACTGAACGTTTGACTATGGG + Intergenic
960161952 3:114360030-114360052 GAAACTGATTTTTTGACTTTGGG + Intronic
960349535 3:116575741-116575763 GAAACTGAACATTTGACTATGGG + Intronic
960494740 3:118360740-118360762 GAAACTGAAGGTTTGACTATGGG - Intergenic
961710976 3:128827975-128827997 GAAACTGAACATTTGACTATGGG - Intergenic
962777056 3:138671680-138671702 GAAACTGAACACTTGAACAAAGG + Intronic
962823249 3:139073611-139073633 GAAAATTAACATTTGACTGAAGG + Intronic
963331810 3:143923333-143923355 GAAACTGAATGTTTGAATATGGG - Intergenic
963355655 3:144206820-144206842 GAAACTGAATGTTTGACTATGGG - Intergenic
963453677 3:145516707-145516729 GAAATTGAACGTCTGACTATGGG + Intergenic
963630315 3:147723260-147723282 GAAACTGAATGTTTGACTATGGG + Intergenic
964136978 3:153355011-153355033 GAAACAGAGCATCTGACTTTGGG + Intergenic
964679238 3:159318874-159318896 GAAACTGAATGTTTGACTATGGG - Intronic
965226760 3:166000724-166000746 GAAACTGACCTTTTGACTATGGG - Intergenic
965291737 3:166889548-166889570 GAAACTGAACTTTTGACTAAGGG - Intergenic
966044323 3:175530881-175530903 GAAACTAAATGTTTGACTATGGG - Intronic
966619283 3:181946453-181946475 GAGAATGAACATTTAACCATAGG + Intergenic
967831783 3:193926030-193926052 GAAACTGAACGTTTGACTGTGGG + Intergenic
968800190 4:2738161-2738183 GAAACTGAATGTTTGACTATGGG + Intergenic
968906953 4:3458007-3458029 GAAACTGAACATTTGACTATGGG + Intergenic
969473770 4:7408893-7408915 GGAACTGAAAATTTCACTAGAGG - Intronic
970002099 4:11374474-11374496 GAAACTGAATGCTTGACTATGGG + Intergenic
971090004 4:23331351-23331373 GAAAATGAACATTTGTCATTTGG + Intergenic
971101008 4:23466382-23466404 GAAACTGAACATTTGACTGTGGG - Intergenic
971769728 4:30880987-30881009 GAAAGTGAAAATCTGACTTTGGG - Intronic
971817233 4:31505115-31505137 GAAACTGAACATTTGACTGTGGG + Intergenic
971979288 4:33732833-33732855 GAAACTGAACGTTTGACTGTGGG - Intergenic
972085229 4:35207142-35207164 GAAACTGACGGTTTGACTATGGG + Intergenic
972095500 4:35342729-35342751 GGAACTGAACATTTGACTATGGG + Intergenic
972201296 4:36717149-36717171 GAAACTAAACGTTTGATCATGGG - Intergenic
972760334 4:42097038-42097060 GCAACTGGACATTTGAGTCTGGG - Intergenic
972805922 4:42529367-42529389 GAAACTGAACATTTGACCATGGG + Intronic
973102931 4:46294792-46294814 GAACATGAACATTCGACTATGGG + Intronic
973118448 4:46489083-46489105 GAAACTGAACATTTGATAATGGG + Intergenic
973130184 4:46639655-46639677 GAAACTGAAGGTTTGACTATTGG - Intergenic
974262364 4:59542229-59542251 GAAACTGATCATTTGACTATGGG - Intergenic
974289574 4:59912782-59912804 GCAAGTAAACATTTGACTATGGG + Intergenic
974479036 4:62420796-62420818 GAAACTGAACATTTGACTATAGG - Intergenic
974564795 4:63568352-63568374 GAAACTGAATGTTTGACTATGGG + Intergenic
974644611 4:64674724-64674746 GAAACTGAATGCTTGACTATCGG - Intergenic
974746909 4:66088865-66088887 GAAACTGAATGTTTGACTACGGG - Intergenic
975386711 4:73767469-73767491 GAAACTGAACATTTGACTATGGG - Intergenic
975982609 4:80177237-80177259 GAAACTGAATGTTTGACTATGGG - Intergenic
976034200 4:80795782-80795804 GAAACTGAATGTTTGACTATGGG - Intronic
977204722 4:94155724-94155746 GAAACTGAACATTTGACTATGGG + Intergenic
977368322 4:96101781-96101803 GAAACTTAAGATTTGATAATTGG + Intergenic
977466007 4:97383414-97383436 GAAACTGAACATTTGACCATGGG + Intronic
977490065 4:97700031-97700053 GAAACTGAACGTTTGACTATGGG - Intronic
977626269 4:99192614-99192636 GAACCTGAATGTTTGACTATGGG - Intergenic
977647368 4:99428665-99428687 CAAACTGATCATTTCACTGTTGG + Intronic
977753114 4:100633257-100633279 GAGACTGAACACTCAACTATGGG - Intronic
977847091 4:101779181-101779203 GAAACTGAACACTTGAACATGGG - Intronic
977930405 4:102743779-102743801 GAAACCAAACCTTTGACTACGGG - Intronic
978341583 4:107725509-107725531 GAAACTGAATGTTTGACTATGGG - Intergenic
978639906 4:110858259-110858281 CAAACTGAGCATTAGTCTATTGG - Intergenic
978772146 4:112467740-112467762 AAAACCGAACGTTTGACTATGGG - Intergenic
978899068 4:113926778-113926800 GAAACTGAACGTCTGACTATGGG - Intronic
978966858 4:114750982-114751004 GAAATTGAATTTTTGACTATGGG + Intergenic
979085138 4:116399334-116399356 GAAACTGAAGCTTTTTCTATAGG + Intergenic
979140525 4:117167455-117167477 CAAACAGAACAAATGACTATAGG + Intergenic
979767026 4:124474635-124474657 GAAACTGAACGTTTGACTATGGG + Intergenic
979888560 4:126062133-126062155 AAAACTGAATGTTTGGCTATGGG - Intergenic
979898396 4:126189017-126189039 GAAACAGAATGTTTGACTATGGG - Intergenic
980385784 4:132086991-132087013 GAAACTGAACATTTGACTATGGG - Intergenic
980387941 4:132111141-132111163 GAAACTGAATGCTTGACTATGGG - Intergenic
980405884 4:132353751-132353773 GAAACCGAACATTTGACTATGGG - Intergenic
980497520 4:133605322-133605344 GAAACTGAATGTTTGACTATGGG - Intergenic
980629527 4:135414326-135414348 GAGACTGAACGTTTGACTATAGG + Intergenic
981162282 4:141512981-141513003 GAATTTGAAAATTTGACTCTCGG + Intergenic
981462816 4:145031838-145031860 GAAACTGAATGTTTGACTATGGG + Intronic
981835010 4:149043985-149044007 GAAATTGAATGTTTGAGTATGGG + Intergenic
981873544 4:149515236-149515258 GAAACCAAACGTTTGACTATGGG + Intergenic
982597771 4:157406986-157407008 GAAACTGAATATTTAACTATGGG - Intergenic
982623334 4:157732861-157732883 GAAACTGAATGTTTGACTATGGG - Intergenic
982835546 4:160116681-160116703 GAAACTGAAAGTTTGACTATGGG + Intergenic
982847775 4:160274336-160274358 GAAACTCAACGTTTGACTATGGG + Intergenic
983027397 4:162755335-162755357 GAAGCTGAATGCTTGACTATGGG + Intergenic
983185070 4:164691615-164691637 GAAACTGAACGTTTGACTATGGG + Intergenic
983582681 4:169324852-169324874 GAAACTGAACATTCAACTATGGG + Intergenic
984060277 4:174981984-174982006 GAAATTGAATGTTTGACTATGGG - Intergenic
984668394 4:182453206-182453228 GAAAGTAAAAATTTTACTATTGG + Intronic
986025580 5:3847454-3847476 GAAACTGAATGTTTGACTATGGG + Intergenic
986037026 5:3950397-3950419 GAAACTGAACGTTTAACTATGGG - Intergenic
986087115 5:4462758-4462780 GAAACTGAACTTTTGACTATGGG + Intergenic
986742926 5:10719546-10719568 GAAACTGAACATTTGACTATGGG + Intronic
986929309 5:12797791-12797813 GAAACTGAAAATTTATCTATGGG - Intergenic
987153183 5:15061706-15061728 GAAACTGAACGTTTGATTATGGG + Intergenic
987657131 5:20821611-20821633 GAAACTGAACATTTAACTGTGGG - Intergenic
987741635 5:21916478-21916500 GAAAATGAAGTTTTGACAATGGG - Intronic
987885451 5:23806540-23806562 GAAACTGAACATTTGACTATGGG + Intergenic
988056562 5:26105227-26105249 GAAACTGAATGTTTTACTGTGGG - Intergenic
988079824 5:26401379-26401401 GAAACTGAATGTTTGACTATGGG - Intergenic
988107764 5:26772587-26772609 GAAACTGAATGTTTGACTATGGG + Intergenic
988160818 5:27516830-27516852 GAAACAAAACGTTTGACTATGGG - Intergenic
988169196 5:27632797-27632819 GATAATGAACGTTTGACTATAGG - Intergenic
988188782 5:27901277-27901299 GAAATGGAACATATGACTATGGG + Intergenic
988228775 5:28448167-28448189 CAAACTGAAGGTTTGACTATGGG + Intergenic
988233283 5:28507049-28507071 GAAACTGAACGTTTGACTACAGG - Intergenic
988562137 5:32290888-32290910 GAAACTGAATGTTTGACTATGGG + Intronic
988766420 5:34382337-34382359 GAAACTGAACATTTGACTGTGGG + Intergenic
989097836 5:37797360-37797382 GAAACTGAACGTTTGACTATGGG + Intergenic
989457636 5:41661727-41661749 GAAACTGAACGTTTGACTTTGGG - Intergenic
989615305 5:43332452-43332474 TAAACTTAACTTTTTACTATAGG - Intergenic
991033551 5:62105963-62105985 GAAACTGAACATTTAACTATGGG + Intergenic
991307852 5:65199583-65199605 GAAACAAAATATTGGACTATGGG - Intronic
991330732 5:65489643-65489665 GAAACTGAATGTTTGACTATGGG - Intergenic
991946153 5:71900182-71900204 GAAACTGAATGTTTGACTATGGG + Intergenic
993203398 5:84847581-84847603 GAAACTGAACATTTGACTATGGG + Intergenic
993231895 5:85247492-85247514 AAAACTGAACATTTGACTATGGG - Intergenic
993412575 5:87591771-87591793 GAAACTGAACGCTTGACTATGGG - Intergenic
993791796 5:92218952-92218974 GAAACTGAACATTTGATTATGGG + Intergenic
993830031 5:92744134-92744156 TAAAATGAACTTTTGACTAGAGG + Intergenic
994198560 5:96946213-96946235 CAAACTGAACAATAGAGTATTGG + Intronic
994291365 5:98031930-98031952 GAAACTGAACGTTTAACTATGGG - Intergenic
994855430 5:105113543-105113565 GAAACTGAATGTTTGACTATGGG - Intergenic
994984414 5:106915688-106915710 TAAACTGAATGTTTGACTGTGGG - Intergenic
995255218 5:110038135-110038157 AAAACTGAAAAATTGCCTATTGG + Intergenic
995261857 5:110113439-110113461 GAAAATGAAAATTTCACTAGTGG - Intergenic
995427728 5:112043685-112043707 GAAACTGAATATTTGACTACAGG - Intergenic
995996502 5:118306841-118306863 GAAATTGAACACCTGACCATGGG - Intergenic
996018565 5:118567897-118567919 GAAACTGAATGTTTGACTATGGG + Intergenic
996105187 5:119493132-119493154 TAAACTGAAGATTTGTCTTTGGG - Intronic
996164950 5:120212467-120212489 GAAACTGAACATTTGACTATGGG - Intergenic
996392198 5:122973744-122973766 GAAACTGAACGCTTGACTATGGG - Intronic
996825569 5:127677876-127677898 GAAACTGAACACTTGACCATGGG + Intergenic
996912237 5:128669015-128669037 GAAACTGAACATTTGACCATGGG + Intronic
998290329 5:140908510-140908532 GAAACTGAACATTTGACTATGGG - Intronic
998326058 5:141280698-141280720 GAGATTGAACATCTGACTATGGG + Intergenic
998692431 5:144601594-144601616 GAAACTGCATATATGACTACAGG - Intergenic
999351392 5:150874886-150874908 GAAACTGAACATTTGACTATGGG + Intronic
1000223239 5:159234207-159234229 GAAACTGAAGGCTTGATTATGGG - Intergenic
1000422866 5:161057997-161058019 GAAACTGAATGTTTGCCCATGGG - Intergenic
1001173601 5:169444686-169444708 AAAACTGAACATTTGACTATGGG + Intergenic
1002685462 5:181005840-181005862 GACACTGGACATATGAATATGGG - Exonic
1002997972 6:2304787-2304809 GAAACTGAACAATTGACTATGGG + Intergenic
1003343911 6:5247288-5247310 GAAACAGAACACTAGACTACCGG + Intronic
1003469915 6:6420033-6420055 GAAACTGAACACTTAGCCATGGG - Intergenic
1003689672 6:8340982-8341004 GCAAGTGAATATTTGAATATTGG - Intergenic
1003758613 6:9150123-9150145 GAAACTGACCGTTTGACTGTGGG + Intergenic
1003791227 6:9550033-9550055 GAAACTAAACATTTGACTATGGG + Intergenic
1004535853 6:16500874-16500896 GAACCTGAATATTTAAGTATGGG - Intronic
1004824283 6:19403194-19403216 GAAACTGAACATTTGACTATGGG - Intergenic
1005185175 6:23157114-23157136 GAAACTGAACGTTTGACTATGGG + Intergenic
1005424870 6:25692255-25692277 GAAACTGAGCAATTATCTATGGG + Intronic
1006062357 6:31433264-31433286 GAAACTGAACATTTGACTATGGG + Intergenic
1008079351 6:47178358-47178380 GAAACTGAACATTTGACTATGGG - Intergenic
1008266916 6:49439247-49439269 GAAACTGAATGTTTGACTATGGG - Intronic
1008793087 6:55263418-55263440 ATAACTGAACACTTGACTTTGGG + Intronic
1008820406 6:55625194-55625216 GAAACTGGATGTTTGACTATGGG + Intergenic
1009308644 6:62122344-62122366 GAAACTGAATGTTTGACTATGGG + Intronic
1009390105 6:63135036-63135058 GAGACTGAACATTTGACTATGGG - Intergenic
1009660689 6:66606880-66606902 GAAACTGAACTTTTGACTATGGG - Intergenic
1009806501 6:68606994-68607016 GAAACTGAATATTTGAATATGGG + Intergenic
1009851920 6:69208916-69208938 GAAACTGAATGTTTGACCATGGG - Intronic
1010108002 6:72190863-72190885 GAAACTGAATGTTTGACCATGGG - Intronic
1010325323 6:74556557-74556579 GAAACTGAACGTTTGACTATGGG - Intergenic
1010378051 6:75196910-75196932 TAAACTGAAAAATTGACTGTGGG + Intronic
1010715971 6:79230790-79230812 GAAAATGAATATTTCAATATGGG - Intronic
1010818637 6:80388449-80388471 GAAACTGAACATTTGACTATGGG + Intergenic
1010854100 6:80815387-80815409 GAAACTTAACACTTGGCCATGGG - Intergenic
1011037933 6:82998183-82998205 TAAACGGAACATTTAATTATTGG - Intronic
1011069109 6:83361707-83361729 GAAACTGAACATTTGACTATGGG + Intronic
1011760974 6:90564940-90564962 GAAACTGAACAATGGACTACTGG + Intronic
1012001912 6:93664488-93664510 AAAACTGAACCTTTGACTGTGGG + Intergenic
1012108563 6:95197695-95197717 GAAACTGAAAGTTTGACTATGGG - Intergenic
1012344595 6:98170361-98170383 GAAACTGAACGTTTGACTGTGGG + Intergenic
1012820810 6:104082960-104082982 GAAACTGAACCTTCAACTGTGGG + Intergenic
1012920788 6:105219503-105219525 GAAACTGAACGTTTGACGATGGG - Intergenic
1013406678 6:109849844-109849866 GTAACTGAATGTTTGACTATGGG + Intergenic
1013904659 6:115200511-115200533 GGAACTGAAAATTTGTCTATGGG + Intergenic
1014363391 6:120508312-120508334 GCAACTGAATGTTTGACCATAGG - Intergenic
1014416992 6:121195431-121195453 GAAACTGAATGTTTGACTGTGGG + Intronic
1014534191 6:122596580-122596602 GAAACTGAACGTTTGACTATGGG - Intronic
1014538826 6:122649720-122649742 GAAACTGAACACCTCACCATGGG - Intronic
1014631648 6:123796843-123796865 GGAACTGAACGTTTGACTATGGG + Intergenic
1014882482 6:126740634-126740656 GAAACAGAAGATTTGACAAAGGG - Intergenic
1015095445 6:129409559-129409581 GAAACTGAATGTTTGACTGTAGG - Intronic
1015466841 6:133557674-133557696 GAAACGGAACATTTGACTATGGG - Intergenic
1015475754 6:133657533-133657555 GAAACTGAACGTTTGACTATGGG + Intergenic
1015562661 6:134533347-134533369 GAGACTGAATGTTTGACGATGGG + Intergenic
1015945233 6:138493430-138493452 AAAACTGAACATCTGTTTATAGG - Intronic
1016119910 6:140332650-140332672 GAAACTGAACGTTTGACTATGGG - Intergenic
1016132833 6:140497968-140497990 GAAACTGAACAATTAACTGTGGG - Intergenic
1016144296 6:140649444-140649466 AAAACGGAAAGTTTGACTATGGG + Intergenic
1016147324 6:140692674-140692696 GAAACTGAATGTTTGACTGTGGG - Intergenic
1016174908 6:141069053-141069075 GAAACTGAACATTTGCATATGGG - Intergenic
1016419608 6:143870640-143870662 GAAACTGAACGTTTGACTGTGGG - Intronic
1016576252 6:145572545-145572567 GAAACTGAACATTTGCATATGGG - Intronic
1017227802 6:152041050-152041072 GAAACTGTATGTTTGACTACAGG - Intronic
1017388449 6:153912165-153912187 GAAACTGAACATTTGACTATGGG - Intergenic
1018122922 6:160655181-160655203 GTAACTGAACGTTTGACTGTGGG - Intronic
1018535024 6:164810452-164810474 GAAACTGAACGCTTGACTATGGG - Intergenic
1018803784 6:167242949-167242971 GAAACTGAACATTGGACTATGGG - Intergenic
1020193037 7:6015114-6015136 GGAAATGAACATTTGGCTGTTGG + Intronic
1020489314 7:8759559-8759581 GAAATTCAACATTTTAATATTGG + Intergenic
1020583294 7:10032582-10032604 GAGACTGAGCATTTAACCATGGG - Intergenic
1021364029 7:19753731-19753753 GAACCTGAGTATTAGACTATAGG - Intronic
1021372058 7:19861392-19861414 GAGACTGCCCATTTAACTATTGG - Intergenic
1021572700 7:22082158-22082180 AACACTGAAATTTTGACTATAGG + Intergenic
1022332449 7:29392761-29392783 AAAACTGTCCATTTGACTCTAGG + Intronic
1022617002 7:31941687-31941709 GGAACTGAACATTGGACTAAAGG + Intronic
1023420042 7:39969474-39969496 GCTACTGAACATTTGAGTACAGG + Intronic
1024040544 7:45550186-45550208 GAAACTGATCGTTTGACCGTGGG + Intergenic
1024866108 7:53906385-53906407 GAAACTGAATGTTTGACTATGGG + Intergenic
1026031614 7:66799023-66799045 GAAAGTGACCATTTGAGAATTGG - Intronic
1026046484 7:66909057-66909079 GAAACTGAACATTTGACTATGGG - Intergenic
1026360128 7:69596513-69596535 GAAACAAAACATTTGACCTTAGG - Intergenic
1027616300 7:80428725-80428747 GAAACTGAACCTCTGATAATTGG + Intronic
1027685803 7:81277996-81278018 GAAACTGAACGTTTGACTATGGG + Intergenic
1028141742 7:87282025-87282047 GAAACTGAACCTTTGACTATGGG + Intergenic
1028237827 7:88382862-88382884 GAAACTGAACGTTCAACTATGGG + Intergenic
1028294715 7:89114143-89114165 GATACTAATCATTTGATTATTGG + Intronic
1028935020 7:96455104-96455126 GAAACTGAATGTTTGACTATGGG + Intergenic
1029321928 7:99769879-99769901 GAGTCTGCACATTTAACTATGGG - Intronic
1030192285 7:106821739-106821761 GAAACTGAACATTTGACCATGGG + Intergenic
1030277464 7:107736155-107736177 GAAACTGAATGTTTGACTAAGGG + Intergenic
1030368760 7:108674068-108674090 GAAACCGAACATTTGACTATGGG + Intergenic
1030453628 7:109744987-109745009 GAGACTGAACATTTAACTCTAGG - Intergenic
1030931280 7:115525642-115525664 GAAACTGAACGTGTTACTATGGG - Intergenic
1031236832 7:119188056-119188078 GAAACTAAACATTTCACCATGGG + Intergenic
1031407374 7:121402920-121402942 GAGATGGAAAATTTGACTATTGG - Intergenic
1031491785 7:122398653-122398675 GAAACAGAAAATATGAATATGGG + Intronic
1031676564 7:124618405-124618427 GAAAATGAACGTTTGACTATGGG + Intergenic
1031833003 7:126650057-126650079 GAAACTGAATATTTGACTATGGG + Intronic
1032153099 7:129446917-129446939 GAAACTGAACGTTTGACTATGGG - Intronic
1032287849 7:130556139-130556161 GAACCTGAACATTTTACAGTGGG + Intronic
1032608686 7:133387793-133387815 CAGACTGAACATTTGTCCATGGG - Intronic
1032923465 7:136576075-136576097 GAAACTGAACATTTGACTATGGG - Intergenic
1033076265 7:138253086-138253108 GAAACTGAACGTTTGACGGTGGG + Intergenic
1035656494 8:1310873-1310895 AAAACTGGAAATTTGACAATGGG + Intergenic
1037019900 8:13957495-13957517 GAGACTGAAAATTTAACCATGGG + Intergenic
1037364589 8:18108235-18108257 GAAACTGAACATTTGACTATGGG - Intergenic
1039324161 8:36466485-36466507 GAAACTGAACGTTTGACTCGGGG - Intergenic
1039626537 8:39060110-39060132 GAAATTGAACATTTAACCATGGG - Intronic
1040030981 8:42823390-42823412 GAAACTGAATGTTTGACCATAGG - Intergenic
1041403256 8:57466849-57466871 GAAACTGAGCTTTTGACATTTGG + Intergenic
1041526893 8:58816472-58816494 AAAACTGAACATTTCAGTAAAGG + Intronic
1041573057 8:59359480-59359502 GAAACAGAACACATGACTTTGGG + Intergenic
1041597623 8:59675419-59675441 AAAACTGAGCATTTTAATATTGG - Intergenic
1041803010 8:61820332-61820354 TAAACTGAACACTTAGCTATGGG - Intergenic
1041849682 8:62376688-62376710 TAGGCTGAACATTTGAATATAGG - Intronic
1041934559 8:63321370-63321392 GAAACTGAACGTTTGACTATGGG + Intergenic
1042001055 8:64123957-64123979 GAAACTGAACTTTTGACTATGGG - Intergenic
1042085608 8:65105600-65105622 GAAACTGAACATTTAACCATGGG - Intergenic
1042674177 8:71301182-71301204 GCTACTGAACATTTAAGTATTGG + Intronic
1042691466 8:71504227-71504249 TAAACTGAACTACTGACTATAGG + Intronic
1042881994 8:73503759-73503781 GAAAGTGAAAATTTGTCTCTTGG + Intronic
1043245248 8:77991170-77991192 GACACTGAACAAGTGATTATAGG - Intergenic
1043259965 8:78184153-78184175 GAAACTGAACGTTTGACTATGGG - Intergenic
1044150805 8:88773115-88773137 GAAACTGAACATCTGACTATGGG + Intergenic
1044202397 8:89452528-89452550 GAAACTGAATGTTTGACTATGGG + Intergenic
1044487145 8:92767082-92767104 GAAACTGAATGTTTGACTATGGG - Intergenic
1044633151 8:94298366-94298388 AAAACTGAATGTTTGACTATGGG - Intergenic
1045221845 8:100207105-100207127 GAAACTGAACATTTGACTATGGG + Intronic
1046029035 8:108761146-108761168 GAAACTAAATATTAGACTCTGGG + Intronic
1046197564 8:110884263-110884285 GAAACTCAGTGTTTGACTATGGG + Intergenic
1046384817 8:113495497-113495519 GACACTGAACACTTAACCATGGG + Intergenic
1046417632 8:113937754-113937776 GAAACTGAATGTTTGACTCTAGG - Intergenic
1046585779 8:116147679-116147701 GAAATTGAACATTTGACTATGGG - Intergenic
1047080685 8:121456498-121456520 GAAACAGAACAGTTGACTGATGG - Intergenic
1047691918 8:127364550-127364572 GAGACTGCACATTTGACAAATGG + Intergenic
1048910080 8:139126797-139126819 GAAACTGAACACTAGACCGTGGG - Intergenic
1050287779 9:4120892-4120914 GCAAATGAACGTTTCACTATAGG - Intronic
1050482681 9:6102643-6102665 GAAACCGAACGTTAGACTATGGG + Intergenic
1051882153 9:21850702-21850724 GAAAGTGAACTTTTGACTATGGG + Intronic
1052227596 9:26108416-26108438 GAAACTCAACTTTTGACTATGGG + Intronic
1052368658 9:27640876-27640898 GAAACTGAATGTTTGACTATGGG + Intergenic
1052442263 9:28512242-28512264 GAAAATGAACATGTGACTATGGG - Intronic
1052561519 9:30089716-30089738 GAAACTGAATGTTTGACTGTGGG - Intergenic
1052895469 9:33743578-33743600 GAGACTGAATGTTTGACCATTGG - Intergenic
1055903933 9:81271164-81271186 GAAACTGAACGTTTGACTATGGG - Intergenic
1056156673 9:83845249-83845271 GAAACTGAACGTTTGACTATGGG + Intronic
1056353865 9:85778278-85778300 GAAACTGAACGTTTGACTATGGG - Intergenic
1058019899 9:100076120-100076142 TAAACTGAATGTTTGACTATAGG + Intronic
1058239803 9:102542533-102542555 GAAGCTGAACATTTGACTATGGG + Intergenic
1058259249 9:102809628-102809650 GAAACTGAGCATTTGACTATGGG - Intergenic
1058544161 9:106042710-106042732 GAAACTGAGCATTTGACTATGGG - Intergenic
1059196499 9:112375828-112375850 GAAACTGAACGTTTGACTATGGG - Intergenic
1059990855 9:119863978-119864000 TAAATTCAACATTTGACCATTGG + Intergenic
1060384047 9:123206326-123206348 GACACTGAATATTTGACATTTGG + Intronic
1061917286 9:133761947-133761969 CAAACTGTACATTTGCCAATGGG - Exonic
1062135477 9:134925063-134925085 GAAACTGAAAGTTTGACTATGGG + Intergenic
1185562933 X:1074473-1074495 GAAACTGGATATTTCACTCTGGG + Intergenic
1186279502 X:7977158-7977180 GAAACTTAACCTTTACCTATGGG + Intergenic
1186469761 X:9812069-9812091 GAAACTGAACATTTGACTATGGG - Intronic
1187604872 X:20871902-20871924 GAAACTAAATGTTTGACTATGGG + Intergenic
1188064098 X:25636099-25636121 TAAACTGCACATTTGACAAATGG + Intergenic
1188311576 X:28623604-28623626 AAAACAGAACATTGGATTATTGG + Intronic
1189032432 X:37464240-37464262 GAAACTGAATATTTGACTATGGG - Intronic
1189154877 X:38746682-38746704 GAAACTGAACGTTTGACTATGGG - Intergenic
1189935718 X:46066552-46066574 GAAATTGAACACTTGAATAAAGG + Intergenic
1190143102 X:47865331-47865353 GAAACTGAACACCTGACCAGTGG - Intronic
1190255323 X:48758178-48758200 GAAACTAAATACTTGACCATGGG + Intergenic
1190527872 X:51346209-51346231 GAGACTGAACAATTAACCATGGG - Intergenic
1190996742 X:55617443-55617465 GAAAGTGAACATTTGACTCTGGG - Intergenic
1191630031 X:63312549-63312571 GAAACTGAATGTTTGACTATGGG - Intergenic
1191658800 X:63629767-63629789 GAAACTGAACGTTTGACTATGGG - Intergenic
1191719234 X:64215670-64215692 GAAACTGAACTTTTGACTCTGGG - Intergenic
1191759366 X:64629963-64629985 GAAACTGAATGTTTGACTGTGGG + Intergenic
1191941254 X:66483827-66483849 GGAAATGAATGTTTGACTATGGG - Intergenic
1191946358 X:66539050-66539072 GAAACTGTACGTTTGACTATGGG + Intergenic
1192291058 X:69795779-69795801 CAACCTGAACATTTCACCATGGG + Intronic
1192657630 X:73008933-73008955 GAAACTGAACACTTGACCATGGG - Intergenic
1192749911 X:73978673-73978695 GAATCTGAGCATTTGATTACTGG - Intergenic
1192898710 X:75471948-75471970 GAAACTGAACGATTGACTATGGG + Intronic
1193297788 X:79852712-79852734 GAAACTGATCGTTTTACTATGGG + Intergenic
1193356260 X:80523161-80523183 GAAACTGAATGTTTGACTGTAGG + Intergenic
1193447162 X:81618809-81618831 GAAACTGAACGTTTGACTATGGG + Intergenic
1193573664 X:83174893-83174915 GAAACTGAACATGTGACTATTGG - Intergenic
1193832954 X:86310135-86310157 GAAACTGAATGTTTGACTATGGG + Intronic
1193914796 X:87351890-87351912 GAAACTGAATGTTTGACTATGGG - Intergenic
1194210282 X:91062392-91062414 GAAACTGAACGTTTGACTATGGG + Intergenic
1194343316 X:92731122-92731144 GAAACTGAACGTTTGGATATGGG + Intergenic
1194443556 X:93961141-93961163 AAAACTGAACATTTGACTATGGG + Intergenic
1194521087 X:94919477-94919499 GAAACAGAATGTTTGACTATGGG + Intergenic
1194626621 X:96233204-96233226 GAACCTGAACATTTGACCATGGG + Intergenic
1194833964 X:98658842-98658864 GAAACTGAACGTTTGATTACGGG + Intergenic
1194849240 X:98852136-98852158 GAAACTGAGCGTTTGACTATGGG - Intergenic
1195782346 X:108479827-108479849 GAAACTGAACATTTGACTATGGG - Intronic
1196135962 X:112209805-112209827 GAAACTGAACATTTGGCTATGGG - Intergenic
1197002296 X:121452962-121452984 GAAACTGAACATTTGTCTATGGG + Intergenic
1197084193 X:122453461-122453483 GAAACACAACGTTTGACTATTGG - Intergenic
1197118060 X:122856660-122856682 AAAACTGACCATGTTACTATTGG + Intergenic
1197245040 X:124158956-124158978 GAAACTGAACGTTTGACTATGGG - Intronic
1197372050 X:125637828-125637850 GAAACTGAACATTTGACTGTGGG - Intergenic
1197379994 X:125727867-125727889 GAAACTGAACAATTGACTATGGG - Intergenic
1197386766 X:125812205-125812227 GAAACTGAACGTTTCACTAGGGG - Intergenic
1197409319 X:126096377-126096399 GAAATTGAACGTTTGACTATGGG - Intergenic
1197477352 X:126941291-126941313 GATGCTGAACGTTTGACTATGGG - Intergenic
1197591872 X:128419425-128419447 GAAAATGAACGTGTGTCTATGGG + Intergenic
1198147558 X:133872677-133872699 TAGACTGAACATTTGTCTACTGG + Intronic
1198170007 X:134096292-134096314 GAGACTGAACACTTGACCATGGG + Intergenic
1198305392 X:135377238-135377260 GAAAGTGAACATTAGAATAAAGG + Intergenic
1198701307 X:139400334-139400356 GAAACTGAAGGTTTGACTATGGG + Intergenic
1198783032 X:140257759-140257781 GAAACTGAAGGTTTGACTATGGG - Intergenic
1198934045 X:141887917-141887939 GAAACTGAATATTTGACTGTAGG + Intronic
1199024385 X:142919757-142919779 GAAACTGAACGTTTGACTATGGG + Intergenic
1199040597 X:143111138-143111160 GAAACTGAAGGTTAGACTATGGG + Intergenic
1199310419 X:146314362-146314384 GAAACCGAATGTTTGACTACGGG - Intergenic
1200340488 X:155390604-155390626 GAAACTGAATGTTTGACTATGGG - Intergenic
1200521277 Y:4212068-4212090 GAAACTGAATGTTTGACTATGGG + Intergenic
1200651674 Y:5847787-5847809 GAAACTGAACGTTTGGATATGGG + Intergenic
1200746050 Y:6904834-6904856 GAAACTGAACATTCAACTATGGG - Intergenic
1200973117 Y:9177672-9177694 AAAACTGAACTTTTGACTATGGG - Intergenic
1200976634 Y:9218518-9218540 GAAACTGAACGTTTGACTATGGG + Intergenic
1201529647 Y:14977856-14977878 TAAATTGAACACTTGACTATAGG - Intergenic
1202134537 Y:21648039-21648061 GAAACTGAACGTTTGACTATGGG - Intergenic
1202137961 Y:21686841-21686863 AAAACTGAACGTTTGACTATGGG + Intergenic