ID: 993212552

View in Genome Browser
Species Human (GRCh38)
Location 5:84971796-84971818
Sequence GGATTAAAACAGATAGCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993212552_993212558 18 Left 993212552 5:84971796-84971818 CCTTGAGCTATCTGTTTTAATCC No data
Right 993212558 5:84971837-84971859 TATTTAATTTCTGAATATTTGGG No data
993212552_993212557 17 Left 993212552 5:84971796-84971818 CCTTGAGCTATCTGTTTTAATCC No data
Right 993212557 5:84971836-84971858 ATATTTAATTTCTGAATATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993212552 Original CRISPR GGATTAAAACAGATAGCTCA AGG (reversed) Intergenic
No off target data available for this crispr