ID: 993225633

View in Genome Browser
Species Human (GRCh38)
Location 5:85165289-85165311
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 611
Summary {0: 41, 1: 78, 2: 97, 3: 99, 4: 296}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993225633 Original CRISPR TGGCAAACAGCAGTGGTGGA CGG (reversed) Intergenic
900289005 1:1915939-1915961 TGGGCAGCAGCAGTGGTGGCAGG + Intronic
901152618 1:7113997-7114019 TGGGTTACAGCAGTGGTGGGAGG - Intronic
901336793 1:8456106-8456128 TGTCAAACAGCAGTATTAGAGGG + Intronic
902225238 1:14992512-14992534 TGGCCAACAGCCCTGGAGGAGGG - Intronic
904917677 1:33982142-33982164 AGGCAAACAGAAGTGGGTGATGG + Intronic
906478501 1:46185590-46185612 TGGCAAGCAGCAGTGATTGGGGG + Exonic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
907602971 1:55788566-55788588 CGGTGAACAGCCGTGGTGGACGG + Intergenic
908411078 1:63866126-63866148 TGCCAAACAGCACTGGTGCTGGG - Intronic
908717659 1:67087517-67087539 CAGCAAACAGAAGTGGTGGACGG - Intergenic
908723227 1:67148228-67148250 CGGCAATCAGCAGTAGTGGACGG + Intronic
908892679 1:68863845-68863867 CGGCCAACAGCAGTGGTGGACGG - Intergenic
910116685 1:83739210-83739232 TGGCAAACAGCAATGGTGGACGG + Intergenic
910590511 1:88924646-88924668 CGGCAAACAGCAGTGGTAGACGG - Intergenic
911739378 1:101370268-101370290 TGTCCAACAGCAGCAGTGGAGGG - Intergenic
912103654 1:106243427-106243449 TGGCAAAAAGCAGTGTTGGCAGG + Intergenic
914044041 1:144076996-144077018 CGGCAAAAAGCCGTGGTGGCGGG - Intergenic
914134016 1:144883472-144883494 CGGCAAAAAGCCGTGGTGGCGGG + Intergenic
916414394 1:164578960-164578982 TGGCAAATAGCAATGGGGGCGGG - Intronic
916961565 1:169894249-169894271 TAGCAAACAGTAGAGGTGCAGGG + Intronic
917097538 1:171414075-171414097 CGGCATTCAGCAGTGGTGGACGG + Intergenic
917215567 1:172674856-172674878 TGGCAAGCAGCACTGGAGGAGGG - Intergenic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
918068389 1:181117450-181117472 TGGAGACCAGCAGGGGTGGAGGG + Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
920029700 1:203029073-203029095 GGGGAAACAGCAGTGGGGGAAGG + Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
921562774 1:216678466-216678488 TGGCAAAAAGAAGTGGGGGAAGG - Intronic
922683933 1:227624877-227624899 CAGCGATCAGCAGTGGTGGACGG + Intronic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1062955771 10:1539401-1539423 AGGCACACAGCACTGGTCGATGG - Intronic
1064168330 10:13005673-13005695 TGGCAAACAGGAATGTTGTATGG - Intronic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1065222798 10:23513377-23513399 AGGCAAACAGCAGTAGTGGACGG + Intergenic
1066144342 10:32541224-32541246 TGGCTACCAGCAGTGGGGGTGGG + Intronic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1066780543 10:38941844-38941866 TGGCAAAAAGCAGCGGCGGCAGG - Intergenic
1066780757 10:38942735-38942757 TGGCAAAAAGCGGTGGTGGCAGG - Intergenic
1066782622 10:38969741-38969763 TGACAAAAAGCCGTGGTGGCGGG - Intergenic
1066950468 10:42111917-42111939 GGGCAAAAAGCCGTGGTGGTGGG + Intergenic
1066950669 10:42112851-42112873 TGGCAAAAAGCCGTAGTGGTGGG + Intergenic
1066950782 10:42113366-42113388 TGGCAAAAAGCCGCGGTGGCAGG + Intergenic
1067552837 10:47247319-47247341 AGGCACCCAGCAGTGGAGGAGGG + Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068988851 10:63131015-63131037 CAGCAAACAGCGGTGGTGGACGG + Intergenic
1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1070400944 10:76053090-76053112 TATCAAACAGCAATGGTTGAAGG - Intronic
1070421931 10:76245800-76245822 TGGAAAGTAGCAGTGGAGGAGGG + Intronic
1070674105 10:78400112-78400134 TGGCATACAGCAGCAGTGGTGGG - Intergenic
1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071327418 10:84530674-84530696 TGGCAAATGGCAGTTGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071490505 10:86133367-86133389 TGGTAAGCAGCAGTGGAGAAAGG - Intronic
1071556992 10:86612081-86612103 CGGCAAACAGCCGTGGTGGACGG - Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072650305 10:97290219-97290241 CGGCAAACAGCAGTGGTAGAGGG - Intronic
1073597440 10:104815061-104815083 AGACAAACAGCACTGATGGAAGG + Intronic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1079574329 11:21984691-21984713 TGACACACAGCAGTGGTGTCTGG + Intergenic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1079700249 11:23537303-23537325 TGCCAAACAGTAGTGGTCCATGG + Intergenic
1079779849 11:24587816-24587838 AGGCAAACAGCTGTGGTGAGAGG + Intronic
1079933258 11:26590806-26590828 CTGCAAATGGCAGTGGTGGACGG + Intronic
1080183765 11:29454763-29454785 TGTCAAACAGCAGTACTGCAAGG - Intergenic
1080881486 11:36325361-36325383 TAGCAAACGGCAGTGGTGGACGG + Intronic
1081069741 11:38595865-38595887 CAGCAAATAGCAGTGGTGGATGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1081905639 11:46667790-46667812 TATCAAACAGCAGTGAGGGACGG + Exonic
1083969120 11:66061905-66061927 TGGCAATCAGCCATGGGGGAGGG - Exonic
1084696423 11:70758339-70758361 CGGTGAACAGCAGTGGTGGATGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085265594 11:75236241-75236263 TGTCTCACAGCAGTGGGGGAGGG + Intergenic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1087901304 11:103644892-103644914 CGGCGTTCAGCAGTGGTGGACGG + Intergenic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088425093 11:109693628-109693650 TGGGCACCAGCAGTGGTGGGTGG - Intergenic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1089030708 11:115325351-115325373 TGCCAAAAAGAAGTGGTGGGGGG + Intronic
1089220719 11:116869244-116869266 TGGCAAACAGGGGTGTTGGCAGG - Intronic
1089642534 11:119857163-119857185 TGCCAGGCAGCAGAGGTGGAAGG + Intergenic
1090711138 11:129386862-129386884 AGGCAGACAGGAGTGGTGGCAGG - Intronic
1091686628 12:2567130-2567152 TGGAAAGCAGCTGTGGAGGATGG - Intronic
1092293641 12:7181266-7181288 TGGTGATCAGCAATGGTGGACGG - Intergenic
1092709046 12:11315062-11315084 TGGGTATCAGCAGTGGTGGCTGG - Intergenic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1094793344 12:33940183-33940205 TGGCAAGCAGCAGTGAAAGAAGG + Intergenic
1095104619 12:38216935-38216957 TGGCAAGCAGCAGTGAAAGAAGG + Intergenic
1095284196 12:40389168-40389190 TGGCATTCAGCAGTGGTTGATGG - Intergenic
1095552470 12:43459166-43459188 CAGCAAACAGCAGTGGTAGGCGG - Intronic
1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG + Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096352553 12:50912232-50912254 TGGAAAACAGCAGTGATGGACGG + Intergenic
1096860988 12:54527961-54527983 TGGAAAAGAGCAGTGGTTGAGGG + Intronic
1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097840840 12:64319958-64319980 CGGCAAACAGGAGTGGTGGACGG - Intronic
1098639878 12:72825637-72825659 CAGCAAACAGCAGTGGTAGACGG + Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1099197794 12:79639733-79639755 TGGCAATTAGCAGTAGTGGCTGG + Intronic
1099292613 12:80790072-80790094 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1100773549 12:97950114-97950136 TGGGAAACAGGGGTGGGGGATGG + Intergenic
1101555299 12:105803059-105803081 CGGCAAGTAACAGTGGTGGATGG + Intergenic
1103516496 12:121511843-121511865 TGGCACACAGCAGCTCTGGATGG + Intronic
1103761605 12:123254222-123254244 TGGCAGACAGCACTGGTGCTTGG + Intronic
1103802552 12:123548793-123548815 TGGTGATCAGCAGTGGTGGATGG - Intergenic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1103873182 12:124106016-124106038 CGGCGATCAGCAGTGGTGGAGGG + Intronic
1104187869 12:126449674-126449696 CGGCCAGCAGCAGTGGTGGACGG + Intergenic
1104485537 12:129148749-129148771 TGGCATGCAGCTGTGGAGGAGGG - Intronic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1104851969 12:131880556-131880578 TGGCATTCAGCAGTGGTGGACGG + Intergenic
1106606661 13:31235030-31235052 TCTCAAACTGCTGTGGTGGAGGG - Intronic
1106619290 13:31358000-31358022 TAGCTAGCAGCAGTGGTGGGAGG - Intergenic
1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG + Intergenic
1107291912 13:38864152-38864174 TGCCATACAGCAGTGGTGTATGG - Intronic
1107299794 13:38953686-38953708 TGATGAAAAGCAGTGGTGGAGGG + Intergenic
1108344095 13:49527308-49527330 AGTCAAACAGCATTGGTGGATGG + Intronic
1108557253 13:51606010-51606032 TGGCAAAAGGCAGTGTTGGATGG + Intronic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109292837 13:60497167-60497189 CGGTGAACAGCAGTGGTGGATGG + Intronic
1109523589 13:63545146-63545168 CGGCCAACAGCACTGGTGGATGG + Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109931290 13:69221993-69222015 CAGCAAACAGTAGTGGTGGACGG - Intergenic
1110125264 13:71934262-71934284 GGCCAAACAGTAGTGGTGGGAGG + Intergenic
1110660990 13:78059440-78059462 CGGCAAACAGCAGTGGTGCATGG - Intergenic
1110846140 13:80192428-80192450 TGGCAACCAGCAGTGGTGGATGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111536801 13:89612121-89612143 CGGCAAACGGCAGTGGTGGACGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1111947493 13:94681218-94681240 GGGAAAAAAGCAGTGGAGGATGG + Intergenic
1112234779 13:97625406-97625428 TGGGAAGCAGCACTGGTGGATGG - Intergenic
1113534720 13:111056598-111056620 TGGCAAATAGCAGCAGTGGATGG - Intergenic
1113592280 13:111509370-111509392 CGGCGATCAGCAGTGGTAGACGG + Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1114390319 14:22301150-22301172 AGGCAAAAAGCAATGTTGGATGG + Intergenic
1114813289 14:25926663-25926685 TGGCAGATAGCTGTGTTGGAAGG - Intergenic
1115151661 14:30293263-30293285 TGGCGAACAGCAGTGGTGGAAGG - Intergenic
1115232242 14:31173598-31173620 TTGGAATCTGCAGTGGTGGATGG + Exonic
1116118809 14:40694756-40694778 CGCCAAACAGCAGTGGTGGATGG + Intergenic
1116420790 14:44729415-44729437 TGTTAAATAGCAGTGGTGGTAGG - Intergenic
1116740324 14:48746699-48746721 CAACAAACAACAGTGGTGGATGG - Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1117828395 14:59726931-59726953 TGAGAAACAGCAGTGGGGGCGGG + Exonic
1118003773 14:61547102-61547124 TTCGAAACAGCAGTGGTGGGGGG + Intronic
1119064060 14:71508096-71508118 TCCCAAACAGCAATGGTGGCTGG - Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119907153 14:78316293-78316315 TGGCAGACAGCTGTGGGGGTAGG + Intronic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120317318 14:82912174-82912196 TAGCAAACAGCAGTAGTGCAGGG + Intergenic
1120341435 14:83225694-83225716 TGTCATTCAGCAGTGGTCGACGG - Intergenic
1120397381 14:83985581-83985603 GCGCAAACAGCAGTGGTGGATGG - Intergenic
1121567628 14:94922731-94922753 TGGGAAACAGCAGCAGAGGAAGG + Intergenic
1122624024 14:103075169-103075191 TGGCAACCAGCCGGGGAGGAAGG - Intergenic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1202894798 14_GL000194v1_random:744-766 TGGCAGGCACCAGTGCTGGAGGG + Intergenic
1123790172 15:23711821-23711843 AGGCAAGGAGGAGTGGTGGAAGG + Intergenic
1123987289 15:25657029-25657051 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1124895132 15:33769444-33769466 TGGCAAACCCCACTGGTGGGTGG + Intronic
1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1126482444 15:49140964-49140986 AAGAAAACAGCAGAGGTGGATGG + Intronic
1126728345 15:51655636-51655658 CGGCAAACAGCAATGGTGGACGG + Intergenic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1126929057 15:53626463-53626485 CGGCAAAGAACAGTGGTGGACGG + Intronic
1127074522 15:55312237-55312259 CGGCAAACAACAGGGGTGGACGG + Intronic
1128351405 15:66892759-66892781 TGGCTAATAGTAGTTGTGGAGGG - Intergenic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1128640588 15:69333430-69333452 TGGCTAATAGTAGTTGTGGAGGG + Intronic
1129060011 15:72853236-72853258 GGGCTCACAGCAGTGGAGGAGGG + Intergenic
1129236630 15:74227596-74227618 TAGCCAACAGCAGTGGTTCAGGG - Intergenic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1131120929 15:89823053-89823075 TGGTGACCAGCAGTGGGGGAGGG + Intergenic
1131420109 15:92298265-92298287 CAGCAAATAGCAGTGGTGGACGG - Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1133539138 16:6731788-6731810 TAGGAAACAGCAGTGGGGAAGGG - Intronic
1134418339 16:14063656-14063678 TGACCAACAGGAATGGTGGATGG - Intergenic
1135070858 16:19350319-19350341 TGTCTAAAAGCTGTGGTGGATGG + Intergenic
1135538580 16:23312882-23312904 TGGTGAAGAGCTGTGGTGGAGGG + Intronic
1136036483 16:27544433-27544455 TGGAAAAGAGCAGGGGTAGAGGG + Intronic
1136072596 16:27796983-27797005 TGGCACACAGCAGGAGTGGGAGG - Intronic
1136105489 16:28027079-28027101 GGACACACAGCAGTGGTGGAGGG + Intronic
1136116593 16:28098460-28098482 TGGGAGACATCTGTGGTGGAAGG + Exonic
1136257129 16:29048823-29048845 TGGCAAAGTGCAGTAGTGAACGG + Intronic
1136938848 16:34500910-34500932 TGGCAAAAACCCGTGGTGGCAGG + Intergenic
1136938954 16:34501442-34501464 TGGCAAAAAGCCGCGGTGGCAGG + Intergenic
1136960866 16:34847114-34847136 TGGCAAAAAGCCGCGGTGGCAGG - Intergenic
1136960972 16:34847646-34847668 TGGCAAAAACCCGTGGTGGCAGG - Intergenic
1138154793 16:54693204-54693226 TTGCAAATTGCAGTGGTGGAGGG - Intergenic
1139548598 16:67661242-67661264 TGGAGACCAGCAGTGGAGGAAGG - Intronic
1140914836 16:79483959-79483981 TGACAAATACCAGTGGTGGTAGG + Intergenic
1141298453 16:82791595-82791617 CAGCAAACAACAGTGGTGGATGG - Intronic
1141705410 16:85661851-85661873 AGGCAAAAAGCAGGAGTGGACGG - Intronic
1142148314 16:88501843-88501865 TGGCAAACAGCAGTGGCAGGAGG - Intronic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1146978295 17:37135349-37135371 TGGCAAACTGGAGTGCTGGCTGG + Intronic
1147211390 17:38874416-38874438 TGGCTCACAGCGGTTGTGGAGGG + Intronic
1147649109 17:42051824-42051846 TGGCACAGAGCAGTGCTGCATGG - Intronic
1147757748 17:42780006-42780028 TGGCAAACAGAAGGGGAGGAAGG + Intergenic
1147987457 17:44314833-44314855 TGCCTGACGGCAGTGGTGGAGGG + Intronic
1148239366 17:45989971-45989993 GGGCACACAGCAGGGCTGGAGGG - Exonic
1148371996 17:47106761-47106783 CGGCAAACAGCACTGGTGGACGG + Intergenic
1148395001 17:47300781-47300803 TGGGAAGCAGAAGTGGTGGATGG - Intronic
1148826730 17:50399327-50399349 CAGCAAACAGCAGTAGTGGACGG + Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1151017843 17:70577585-70577607 CGGCGAACAGCAGTGGTGAACGG - Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1152272969 17:79336008-79336030 TGGCAAACAGCACAGAGGGAGGG - Intronic
1152791873 17:82284479-82284501 AGGCAGAAAGCAGTGGGGGAGGG + Intergenic
1152866839 17:82729221-82729243 TGGCAAACACCCGTGTTTGAGGG + Intronic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1154052147 18:10971127-10971149 TGGCAAACAGCAGAGGATAAGGG + Intronic
1154275325 18:12954324-12954346 TGGCCAACAGGAGGGGTGTAAGG + Intronic
1155749242 18:29399246-29399268 CGGCAAACGGCAGTGGTGGATGG + Intergenic
1156036241 18:32770636-32770658 TGGCAGACAGGGGTGGGGGATGG + Intronic
1156908420 18:42381924-42381946 TTACAAATAGCAGTGGAGGAAGG - Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1157332916 18:46716525-46716547 TGGCAAAGAGGAGGTGTGGAAGG - Intronic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158470799 18:57735192-57735214 AGCAAAACAGCAGTGGTGGACGG - Intronic
1158580908 18:58681951-58681973 TGGTCTACAGCAGTGGTGGAGGG + Intronic
1160102769 18:75938543-75938565 CGGCAAACAGCAATGGTGGACGG + Intergenic
1161321819 19:3644940-3644962 TGGCAAACAGCCCTGGATGACGG + Intronic
1161986151 19:7655604-7655626 GGGCCAGCAGCAGTGGTGGTGGG + Intergenic
1162007761 19:7790724-7790746 TGGTTCTCAGCAGTGGTGGATGG - Intergenic
1163901126 19:20101075-20101097 CGGCAAACAGCAGTGGTCGACGG - Intronic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1165131758 19:33636956-33636978 GGGCAACCAGCAGTGGTTGGGGG - Intronic
1165772002 19:38385573-38385595 TGCCTGACAGCAGTGGTGGAGGG - Exonic
1165926091 19:39327208-39327230 AGGAAAACAGCACTAGTGGAGGG + Intergenic
1166987457 19:46669881-46669903 TGGCAGACAGGAGTGTTGTAGGG + Intergenic
1167671800 19:50857847-50857869 TGGGAAACAGCAGTGTGAGAGGG - Intronic
1167694246 19:51004943-51004965 TGGTAAACAGAAGTCGGGGACGG + Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1202683272 1_KI270712v1_random:29309-29331 CGGCAAAAAGCCGTGGTGGCGGG - Intergenic
924973622 2:153902-153924 CGACAAACAGCACTGGTGGACGG + Intergenic
924974508 2:160386-160408 CGACAAACAGCCGTGGTGGATGG + Intergenic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
925249145 2:2415601-2415623 TGGCAGTCAGCACTGGTGAAAGG + Intergenic
925554232 2:5111545-5111567 TGAAAAAAAGCAATGGTGGAGGG - Intergenic
925684628 2:6458580-6458602 TGGTGAAGAGCAGGGGTGGAGGG + Intergenic
926864982 2:17346308-17346330 GGCAAAACAGCAGTGGTAGATGG - Intergenic
927640187 2:24841113-24841135 TGGGACACAGCACTGGTTGATGG - Intronic
927820330 2:26258604-26258626 TGGCGAACAGCAGTGGTGGAAGG + Intronic
927826353 2:26312423-26312445 TGGTGACCAGCAGTGGTAGAGGG + Intronic
928298237 2:30103996-30104018 TGGCAAACAGTAGTGATGACCGG - Intergenic
928348185 2:30519878-30519900 TGGCATTCAGCAGTGGTGGATGG - Intronic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
928676629 2:33657541-33657563 CGGCAAACAGCAGTGGTAGATGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
930631150 2:53756757-53756779 CGGTGATCAGCAGTGGTGGACGG - Intronic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931471378 2:62541013-62541035 TGGCAGACAGCAGAAGGGGAGGG + Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
932918178 2:75879091-75879113 CGGCAAACAGCAGTGGTAGACGG - Intergenic
933958340 2:87390069-87390091 TGAGAAACAGCAGAGGTGTACGG - Intergenic
934242466 2:90281986-90282008 TGAGAAACAGCAGAGGTGTACGG - Intergenic
934270709 2:91534697-91534719 TGAGAAACAGCAGAGGTGTACGG + Intergenic
934886280 2:98028369-98028391 TCGCACGCAGCAGGGGTGGAGGG - Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
937594968 2:123661568-123661590 CGGCAAACAGCTGTGGTGGACGG - Intergenic
937792630 2:125978675-125978697 TGGCAAGGGGCAGGGGTGGATGG + Intergenic
938035702 2:128033142-128033164 TGGCAAATGGCAGAGGTGGTGGG + Intergenic
939090695 2:137776818-137776840 TGGCTAACAGCTCAGGTGGAAGG - Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939494109 2:142907501-142907523 TGGCAAATAGCAGTTGTGGATGG + Intronic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
940769788 2:157827815-157827837 TGTCACACAGCAGTGGTGCGGGG - Intronic
940858093 2:158745441-158745463 TGGCTGAACGCAGTGGTGGAAGG - Intergenic
941063308 2:160872491-160872513 TGGGTAACAGCAGTGGAGGTAGG + Intergenic
941395565 2:164968911-164968933 TGGCGATCAGCAGTGGTGGACGG + Intergenic
942580696 2:177413017-177413039 CGGCAAACAACAGTGGTGGATGG + Intronic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
942830304 2:180232054-180232076 TGGCGAATGGCAGTGGTGGATGG - Intergenic
942831223 2:180238913-180238935 TGTTGAACAGCAGTGGTGGACGG - Intergenic
943019252 2:182552900-182552922 CGGCAAACAGCTGTGGTGGATGG - Intergenic
943345695 2:186734761-186734783 TGGGAAACAGCAGAGGCTGAGGG - Intronic
945064768 2:205939542-205939564 TGGCAAATAGCAGTGGTGGACGG - Intergenic
945834118 2:214818945-214818967 TAGCACACACCACTGGTGGATGG - Intergenic
947493017 2:230611999-230612021 GGGCACACAGCAGTGATGCAGGG + Intergenic
948087529 2:235263983-235264005 TGTCACACAGCCCTGGTGGATGG - Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172781662 20:37440101-37440123 AAGCAAACAGCAGAGGTGGCAGG - Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173748968 20:45461268-45461290 TGGCAAACATCAGTGTTTGAGGG + Intergenic
1173822950 20:46030493-46030515 TGGCTGACAGCCGTGATGGATGG - Intronic
1174708977 20:52685192-52685214 TGGCAGAGTGCAGTGGGGGAAGG + Intergenic
1174857642 20:54061877-54061899 TGGCAAAGAACAGCGGTGGCTGG + Intronic
1175709673 20:61209266-61209288 TGACTAACAGAAGTGGAGGAAGG - Intergenic
1176614497 21:9016731-9016753 TGGCAGGCACCAGTGCTGGAGGG + Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177738119 21:25118775-25118797 CGGGGAACAGCAGTGGTAGAGGG - Intergenic
1177797093 21:25790276-25790298 TGGCATACAGCAGCGGGGGAAGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178535985 21:33410963-33410985 TGGGAAACACCAGGGCTGGAAGG - Intronic
1178900804 21:36596989-36597011 TGGCAGGCAGCGGGGGTGGAGGG + Intergenic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179444728 21:41423260-41423282 CAGCAAATGGCAGTGGTGGATGG + Intronic
1179565857 21:42248328-42248350 GTCCAGACAGCAGTGGTGGAGGG + Intronic
1180057677 21:45367293-45367315 TGGCAGCCAGCAGTGGGAGAGGG - Intergenic
1180727559 22:17957890-17957912 TGGAAGACAGCTGTGGTGGCTGG + Intronic
1181626924 22:24128663-24128685 GAGGAAACAGGAGTGGTGGAGGG - Intronic
1182221360 22:28761554-28761576 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1184306757 22:43608284-43608306 TAGCAAGCAGCCTTGGTGGATGG - Intronic
1184847805 22:47099910-47099932 TGTCAAACACCAGGGCTGGAAGG - Intronic
949212186 3:1516230-1516252 AGGCAACCAGCAGTCCTGGAGGG + Intergenic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
949943573 3:9172999-9173021 AGGCAAACAGGAGAGGTGGTGGG + Intronic
950529317 3:13544040-13544062 TGGCAAACACCAGTGTTCAAAGG + Intergenic
950719926 3:14875510-14875532 TGGCATGGAGGAGTGGTGGAGGG + Intronic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951201178 3:19876492-19876514 TGGCAAACAGCAGTGGTAGACGG + Intergenic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
952653742 3:35758631-35758653 TGGCAAACAGCAGGGCTGAAGGG - Intronic
952921717 3:38289782-38289804 CGACAAACAGCAGTGGTGGACGG + Intronic
952922699 3:38296929-38296951 CGACAAACAGCAGTGGTGGACGG + Intronic
953515821 3:43591187-43591209 CGGCGAACAGCAGTGGTGGATGG - Intronic
953853131 3:46480990-46481012 TGCCTATCAGCAGTGGAGGAGGG - Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
955774664 3:62420547-62420569 TGGCAGGCAGCACAGGTGGATGG + Intronic
956884241 3:73542924-73542946 TGGCAAACTCCAGTTATGGAAGG - Intronic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957280295 3:78142881-78142903 TGGCTAACAGCAGGGTTGGCTGG + Intergenic
957296912 3:78344277-78344299 CGGCAAACCCCAGTGGTGGATGG + Intergenic
957557721 3:81782297-81782319 CAGCAAACAACAATGGTGGATGG - Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
957895103 3:86411956-86411978 TGGCGTTCAGCAGGGGTGGACGG - Intergenic
958043330 3:88252213-88252235 TTGCAAATATCAGTGTTGGAGGG - Intergenic
958424501 3:93965270-93965292 CGGCAAACAGCAGTTGTGGACGG - Intronic
958457051 3:94345318-94345340 CAGTGAACAGCAGTGGTGGACGG + Intergenic
959161776 3:102732820-102732842 CGGCAAACAACAGTGGTGGATGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960244659 3:115386909-115386931 TTGCAAATAGCAGTAGTGGTGGG - Intergenic
960995160 3:123335822-123335844 GGGGAAACAGCAGTGGTTGGGGG - Intronic
961905772 3:130261469-130261491 TGGGATACAGCAATGGAGGATGG - Intergenic
962927213 3:140005847-140005869 TGGCAAACAGCAATGGCAAAAGG + Intronic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963255679 3:143142484-143142506 CGGCGTTCAGCAGTGGTGGATGG - Intergenic
963492266 3:146016733-146016755 CGCAAAACAGCAGTGGTGGAGGG - Intergenic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
964432558 3:156622124-156622146 TGGCAAACAGTATTGATGGGTGG - Intergenic
965342138 3:167503710-167503732 TGGCCAGCAGCAGTGGTGGAGGG + Intronic
965811000 3:172591896-172591918 TGACAAGCAGCAGGGGTGGATGG + Intergenic
966353265 3:179054718-179054740 CGGCAAGCAGCAGTGTTGGATGG - Intronic
966994303 3:185265012-185265034 CGGCACTCAGCAGTGGTGGATGG - Intronic
968288378 3:197521277-197521299 TAGAATACAGCAGTGGGGGATGG - Intronic
968390877 4:192146-192168 TGGTGATCAGCAGTGGTGGATGG + Intergenic
968901570 4:3434568-3434590 CGGGACACAGCAGTGCTGGAGGG - Intronic
969055118 4:4396839-4396861 TGGCATTCAGCAGTGGGGGTGGG + Intronic
969120372 4:4904291-4904313 TGGCAGACAGCAGTGGACTATGG - Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969645654 4:8427399-8427421 CAGCCATCAGCAGTGGTGGATGG - Intronic
970718316 4:18955275-18955297 TGAGAAGCAGCAGTGGTAGAAGG + Intergenic
970738116 4:19198142-19198164 CCGCAAACAGCAGTGGTGCACGG + Intergenic
971980348 4:33742943-33742965 GGCAAAACATCAGTGGTGGACGG - Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
974190486 4:58496555-58496577 TGGCGATCAGCAGTGGTGGACGG + Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
974841794 4:67307594-67307616 CAGAGAACAGCAGTGGTGGATGG - Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
975844566 4:78511403-78511425 TGCCACACACCAGTGGTGGCTGG + Intronic
975980888 4:80157961-80157983 TGGCAGTCAGGAGTGGTGGGAGG - Intergenic
976189289 4:82473690-82473712 CAGCAATCAGCAGTGGTAGATGG - Intergenic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
976832611 4:89332119-89332141 TGGCAGACAGCTTTAGTGGAGGG - Intergenic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977342088 4:95771734-95771756 TGACAATCAGCAGTGGTGGATGG - Intergenic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
977618439 4:99109817-99109839 TGGCAGCAAACAGTGGTGGACGG + Intergenic
977769849 4:100845388-100845410 TGGCAGACAGCAGTGAGAGATGG + Intronic
977919114 4:102624348-102624370 TCGCTGGCAGCAGTGGTGGAGGG - Intergenic
978046040 4:104128924-104128946 AGGCAAACAACTGTGGAGGATGG + Intergenic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
978909017 4:114044497-114044519 TAGCCAGCAGCAGTGGTGGACGG - Intergenic
979450603 4:120866091-120866113 TGGCAAACAGCATTGGTATGAGG - Intronic
979673548 4:123386056-123386078 TGGCAGACAACATTGGTGGTGGG - Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980386303 4:132090774-132090796 CAGCAAACAGCAGTGATGGATGG + Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980790429 4:137613267-137613289 CGTCAAGCAGCAGTGGTGGATGG - Intergenic
980871972 4:138622139-138622161 TGGCAAACAGCAGTGGTGCATGG + Intergenic
981823740 4:148915589-148915611 TGGAGATCAGCAGTGGTGGATGG - Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983660519 4:170126752-170126774 AGGAAAACATGAGTGGTGGAAGG - Intergenic
983666276 4:170188271-170188293 TGGCAGACAACAGTGGGGGCTGG + Intergenic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984257778 4:177408296-177408318 CAGCAATCAGCAGTGGCGGACGG + Intergenic
984365393 4:178792990-178793012 GAGCAAAAAGCAGAGGTGGAGGG - Intergenic
984924603 4:184795640-184795662 TGGTAATGAGCAGTGGTGGTTGG - Intronic
985226354 4:187765516-187765538 CAGCTAACAGTAGTGGTGGATGG - Intergenic
986492622 5:8307849-8307871 TGGTGAACAGCAGTGGTGGATGG + Intergenic
986887348 5:12256134-12256156 TGGAAAAAAGCAGTGGAGGAAGG - Intergenic
987026927 5:13936843-13936865 TGGCAGCCAGCAGAAGTGGATGG + Intronic
987508221 5:18800422-18800444 GGCAAAACAGCAGTGGTGGAGGG - Intergenic
987738468 5:21874686-21874708 CTGTGAACAGCAGTGGTGGATGG - Intronic
987855123 5:23411299-23411321 CGGCGATCAGCAGTGGTGGACGG - Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989233459 5:39115461-39115483 TGGAAAACAGCAGTGGATGAGGG + Intronic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
989717696 5:44483491-44483513 CAGCAAATAGCAGTGGTGGACGG - Intergenic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
990892804 5:60666076-60666098 TGGCAAACAACAGTGGTGGACGG - Intronic
991290608 5:65030855-65030877 CCGGAAACGGCAGTGGTGGATGG - Intergenic
991677793 5:69105947-69105969 TTCCAGACAGCAGTGGTGGGGGG - Intronic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992932635 5:81665343-81665365 TGCCACACAGCACTGATGGATGG + Intronic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993590947 5:89794630-89794652 CGGCCAACAGCAGTGGTGGATGG - Intergenic
993622826 5:90188273-90188295 CGGCGTTCAGCAGTGGTGGACGG + Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
995125595 5:108574491-108574513 AGCGAAACAGCAGTGGTGGATGG + Intergenic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
995717278 5:115092614-115092636 CAGCTATCAGCAGTGGTGGATGG - Intergenic
996019247 5:118573683-118573705 AGGAAAACGGCAGTGGGGGAAGG - Intergenic
996128268 5:119751524-119751546 TGGCAAACAGCAGTGGCAGATGG - Intergenic
996939816 5:128990943-128990965 CGGAGATCAGCAGTGGTGGACGG + Intronic
997905223 5:137809603-137809625 AGGCAAACAGCAGTGATGGCTGG + Intergenic
999653772 5:153793313-153793335 TGGCAAGGAGCACTGATGGAAGG - Intronic
1000202341 5:159023882-159023904 GGGCAAACAGGAGGAGTGGAAGG + Intronic
1000266718 5:159645093-159645115 TGGAAAGCAGCAGGGGTGGGGGG + Intergenic
1000306704 5:160001332-160001354 TGGATAACTGGAGTGGTGGAGGG + Intergenic
1003360999 6:5425137-5425159 TGCCAAACACCAGTGGTTAATGG + Intronic
1003647138 6:7922146-7922168 TGGCAGACAGCAATAGTGGTTGG + Intronic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1004694746 6:18023191-18023213 TGACAAACAGCAGTGTTCCAGGG - Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005358865 6:25011141-25011163 TGGCAATGAGCAGTGGAGGGAGG + Intronic
1005816651 6:29558585-29558607 TGGCAAACGGCAGTGGTGGATGG - Intronic
1007011949 6:38426521-38426543 GGCAAAACAGCAGTGGTGGATGG - Intronic
1007102900 6:39262134-39262156 TGGCTCAGAGCAGAGGTGGATGG - Intergenic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009229363 6:61043668-61043690 TGGTGAACAGCAGTGGGGGTGGG + Intergenic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1009765687 6:68072057-68072079 TGCAAAACACCAGTAGTGGAGGG + Intergenic
1009885202 6:69617025-69617047 GGGTGATCAGCAGTGGTGGACGG - Intergenic
1010186407 6:73148956-73148978 TGTCAAAGAGCAGTGGGTGATGG + Intronic
1011189091 6:84712068-84712090 CGGTGAACAGCAGTGGCGGACGG + Intronic
1011190324 6:84720755-84720777 CAGCGAACAGCAGTGGTGGATGG + Intronic
1011540395 6:88421360-88421382 CGGCAAACAACAGTGGTGGACGG + Intergenic
1012009981 6:93771491-93771513 TGGAAAAGAGCAGTTTTGGAAGG + Intergenic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1012848817 6:104423429-104423451 TGACAAGCAGAAGTGATGGAAGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013410504 6:109879599-109879621 TGGTGATCAGCAGTGGTGGACGG - Intergenic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1016108533 6:140192007-140192029 TGGCTAATAGCAGTTGTGGAGGG + Intergenic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1018101888 6:160447387-160447409 AGGGAAACAGAAGTGCTGGAGGG - Intronic
1018133767 6:160757822-160757844 AGGGAAACAGAAGTGCTGGAGGG + Intergenic
1018632360 6:165832242-165832264 TGGGAGACAGAAGTGGTGGTGGG + Intronic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1021144253 7:17065920-17065942 CAGCGAACAGCAGTGGTGGACGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022643957 7:32213621-32213643 AGGCAAGCAGCAGTGTTTGAGGG - Intronic
1022651805 7:32284279-32284301 GGGCAAACTGCTATGGTGGAAGG + Intronic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1023169592 7:37377751-37377773 TAGCAAACAGCCTTGGAGGAGGG - Intronic
1023282935 7:38590385-38590407 CGGCATTCAGCAGTGGTGGATGG + Intronic
1023878164 7:44302863-44302885 TGTCGAATAGCAGTGGTGAAAGG - Intronic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1024156766 7:46633986-46634008 AGGCAATGAGCAGTGGAGGAAGG - Intergenic
1024709723 7:52002049-52002071 TGGGAAACAGCAGGAGAGGAAGG + Intergenic
1024853144 7:53744543-53744565 GGGCTAGCAGCAGTGGTGGTGGG - Intergenic
1025320136 7:58087036-58087058 GGGCAAAAAGCTGTGGTGGCAGG - Intergenic
1025320253 7:58087544-58087566 TGACAAAAAGCTGTGGTGGCGGG - Intergenic
1026346967 7:69482805-69482827 CGGCAAACAGCGGTGGTGGACGG - Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028041392 7:86058715-86058737 TGGCAAGGAGCAGTGGGGGTGGG + Intergenic
1028391580 7:90322455-90322477 TGGAAAACAGCTTTGGTGGGTGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030431253 7:109452177-109452199 CGGCAAACTGCAGTGGTGGACGG - Intergenic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032087134 7:128890447-128890469 TGGCAGGCAGCAGTGGGCGATGG + Exonic
1032425796 7:131821204-131821226 CGGCATTCAGCAGTGGTGGAGGG + Intergenic
1032447557 7:131997660-131997682 GAGCAAACAGGAGTGATGGATGG - Intergenic
1032540494 7:132699126-132699148 TCCCAAACAGCAGGGGTGGTGGG - Intronic
1032901957 7:136320483-136320505 TGGGATACAGCAGTAGTGGTGGG + Intergenic
1033556919 7:142496181-142496203 AGGCAATAAGCAATGGTGGAGGG - Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035256762 7:157634022-157634044 TGGGGAACAGCAGTGGAGGCGGG + Intronic
1035624544 8:1061098-1061120 TGGAAAACAGACCTGGTGGATGG - Intergenic
1035920201 8:3668223-3668245 TGAGATCCAGCAGTGGTGGACGG - Intronic
1036796017 8:11757400-11757422 TGGCATACAGCATGGGTGGCAGG + Intronic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1037648693 8:20817066-20817088 TGACCAGCAGCAGTGGTGGATGG + Intergenic
1039440143 8:37589314-37589336 TTGAAAACATCAGTGCTGGAGGG - Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1040768454 8:50944307-50944329 CGCCCAAAAGCAGTGGTGGACGG + Intergenic
1041266580 8:56071540-56071562 TGGGTAACAGCAGTAGGGGAGGG + Intronic
1041789424 8:61676369-61676391 TGGAAAAAAGAAGTGGAGGAAGG + Intronic
1041945245 8:63433610-63433632 TGCCAAACAGCAGTGTTGAAGGG + Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1042673716 8:71293892-71293914 TGTCGAACAGGAGTGGTAGAGGG - Intronic
1043484194 8:80682714-80682736 TGCCAAACGGCGGTGGGGGAGGG + Intronic
1043603544 8:81971329-81971351 TGGCAAACAGCAGTGGGGGTGGG + Intergenic
1043673537 8:82919855-82919877 TGGCACACAGCACTGGTGATTGG + Intergenic
1043804497 8:84654572-84654594 AGGGAAAGAGCAGTGGTGGTAGG - Intronic
1044487053 8:92766392-92766414 TGGACAACAGCAGAGGTGGCTGG + Intergenic
1044543517 8:93433902-93433924 TGGAGAGCAGCAGTGGTCGAGGG - Intergenic
1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1045586562 8:103544397-103544419 TGGCTACCAGCAGTGGAGGTGGG - Intronic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1048100260 8:131343232-131343254 TGGTGATCAGCAGCGGTGGACGG + Intergenic
1048631490 8:136247645-136247667 CAGCAAACAGCAGTGGTGAATGG - Intergenic
1049051827 8:140203822-140203844 TGGGTACCAGGAGTGGTGGAAGG + Intronic
1049491281 8:142904457-142904479 TGGCAAAGAACAGTGGGGGTTGG - Intronic
1049861697 8:144902849-144902871 TGGCACACAGAAGTGCTGGCGGG + Intergenic
1050067598 9:1777001-1777023 TGGCAACCAGCAGTGGGAGATGG - Intergenic
1050113680 9:2241902-2241924 TTGCACACACCAGGGGTGGAGGG - Intergenic
1050116061 9:2264607-2264629 AGGCAATCAGCAGCAGTGGATGG + Intergenic
1050593498 9:7183541-7183563 TAGCAAACAGCAATGGTAGACGG - Intergenic
1050863757 9:10470800-10470822 AAGGAAACAGGAGTGGTGGAGGG + Intronic
1051612141 9:18971282-18971304 AGGCAAGCAGCAGTGGGGCATGG - Intronic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1051970178 9:22878077-22878099 CAGCCAACAGCAGTGGTGGACGG + Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1053414324 9:37937498-37937520 TGGCAAACACTCGTGCTGGAAGG + Intronic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG + Intergenic
1056786370 9:89595202-89595224 TGGAAAATAGCAGAGATGGATGG + Intergenic
1057702992 9:97376993-97377015 CGGCACAGAGCAGGGGTGGAGGG - Intronic
1059067999 9:111105344-111105366 TGACAATCAGTATTGGTGGAGGG - Intergenic
1059287723 9:113190488-113190510 TGGAATCCAGCTGTGGTGGAAGG + Exonic
1059634554 9:116158123-116158145 TGGCAAGCAGAGGTGCTGGATGG - Intronic
1060462901 9:123875511-123875533 TGGAGAAAAGCAGTGGTGCAGGG + Intronic
1060960629 9:127678302-127678324 TGGCAAAGAGTAATGGTGGGGGG - Intronic
1061302994 9:129716812-129716834 TTGCAAAAAGCAATGCTGGAGGG + Intronic
1062674429 9:137732129-137732151 TGGCAAGCAGCAGTGGAGCCAGG - Intronic
1185560908 X:1060072-1060094 CGGCGTTCAGCAGTGGTGGACGG - Intergenic
1186397624 X:9225666-9225688 TGGTTAACAGCAGTTATGGAGGG - Intergenic
1187701510 X:21968168-21968190 TGGCCAGCAGCAGTGCTGCAGGG + Intronic
1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG + Intergenic
1188285579 X:28322485-28322507 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1189152100 X:38719513-38719535 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1189239930 X:39517140-39517162 TGGCAAGCAGCCCAGGTGGAAGG + Intergenic
1189558160 X:42166260-42166282 GGGGAAACTGCAGTGGTGGGAGG + Intergenic
1189954280 X:46262003-46262025 CAGCAAACAGCAGCGGTGGGCGG + Intergenic
1189954702 X:46265321-46265343 GCTCAAAGAGCAGTGGTGGAGGG + Intergenic
1191040135 X:56069540-56069562 TGGCTACCAGCAGTGGGGGTGGG - Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192940372 X:75904933-75904955 TGACAAACAGCAGTGGTGGATGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193010473 X:76669818-76669840 TAGCAAACTGCAGTACTGGAGGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1193328354 X:80207807-80207829 TGGCAAGGAGCAGTGGAGGTAGG + Intergenic
1193443972 X:81577346-81577368 TGGCAAGGAGCAGTGGGGGTAGG - Intergenic
1193582956 X:83287140-83287162 TGGGTATCAGCAGTGGTGGCTGG - Intergenic
1195137239 X:101921168-101921190 TTGAAAACAACCGTGGTGGAAGG - Intronic
1195146909 X:102027125-102027147 TGGGATCCAGCAGTGGTGGATGG - Intergenic
1195256572 X:103096771-103096793 TGCAATACAGCAGTGGTGAATGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195584602 X:106551389-106551411 CAGCAAACAGCAGTGGTGGTCGG - Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196772529 X:119309158-119309180 CGGCAAACACCAGTGGTGGATGG + Intergenic
1196993630 X:121356620-121356642 TGGCGATCAGCAGTGGTGGACGG - Intergenic
1197091096 X:122538677-122538699 TGGCAAAAAGCAGGTGTAGAAGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1199368802 X:147020883-147020905 CGGCAAACAGCAGTGGTCGACGG - Intergenic
1199432073 X:147773164-147773186 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1199536297 X:148906769-148906791 CGGCATTCAGCAGTGGTGGACGG - Intronic
1200415982 Y:2910352-2910374 CGGCGATCAGCAGTGGTGAACGG + Intronic
1200849217 Y:7865528-7865550 TGGTGACCAGCACTGGTGGATGG + Intergenic
1200851945 Y:7892248-7892270 TAGCATTCAGTAGTGGTGGATGG + Intergenic
1201329227 Y:12800001-12800023 CGGCATTCAGCAGTGGTGGAAGG - Intronic
1201421473 Y:13804542-13804564 CAGCAAACAGCAGTAGTGGAGGG - Intergenic
1201724349 Y:17136736-17136758 TAGCATTCAGCAGTGGTGGATGG + Intergenic
1201905226 Y:19080314-19080336 TGGCAAAGAGCATTGCTGGATGG - Intergenic
1202075908 Y:21037863-21037885 TGGCAGACAGGAGTGGGGGGGGG - Intergenic