ID: 993229159

View in Genome Browser
Species Human (GRCh38)
Location 5:85209885-85209907
Sequence TACAAACAGCAGTGGATCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993229156_993229159 27 Left 993229156 5:85209835-85209857 CCATCAGCTGTTTTCTGTGTTAC No data
Right 993229159 5:85209885-85209907 TACAAACAGCAGTGGATCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993229159 Original CRISPR TACAAACAGCAGTGGATCAA GGG Intergenic
No off target data available for this crispr