ID: 993231682

View in Genome Browser
Species Human (GRCh38)
Location 5:85245872-85245894
Sequence TAGGCTAAGAAGGGAGTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993231682_993231688 13 Left 993231682 5:85245872-85245894 CCTGTAACTCCCTTCTTAGCCTA No data
Right 993231688 5:85245908-85245930 GGAAGCCCAAAGTGTCCAGGTGG No data
993231682_993231687 10 Left 993231682 5:85245872-85245894 CCTGTAACTCCCTTCTTAGCCTA No data
Right 993231687 5:85245905-85245927 TGTGGAAGCCCAAAGTGTCCAGG No data
993231682_993231685 -8 Left 993231682 5:85245872-85245894 CCTGTAACTCCCTTCTTAGCCTA No data
Right 993231685 5:85245887-85245909 TTAGCCTATTGACTTAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993231682 Original CRISPR TAGGCTAAGAAGGGAGTTAC AGG (reversed) Intergenic
No off target data available for this crispr