ID: 993231902

View in Genome Browser
Species Human (GRCh38)
Location 5:85247535-85247557
Sequence TCCTTTTAAGAGACAGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993231902_993231904 4 Left 993231902 5:85247535-85247557 CCAAGAGCTGTCTCTTAAAAGGA No data
Right 993231904 5:85247562-85247584 AGTTTTCTGCAAAAGATGGCAGG No data
993231902_993231903 0 Left 993231902 5:85247535-85247557 CCAAGAGCTGTCTCTTAAAAGGA No data
Right 993231903 5:85247558-85247580 GAATAGTTTTCTGCAAAAGATGG No data
993231902_993231905 27 Left 993231902 5:85247535-85247557 CCAAGAGCTGTCTCTTAAAAGGA No data
Right 993231905 5:85247585-85247607 AACTTTCTCCAAAATCCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993231902 Original CRISPR TCCTTTTAAGAGACAGCTCT TGG (reversed) Intergenic
No off target data available for this crispr