ID: 993231904

View in Genome Browser
Species Human (GRCh38)
Location 5:85247562-85247584
Sequence AGTTTTCTGCAAAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993231902_993231904 4 Left 993231902 5:85247535-85247557 CCAAGAGCTGTCTCTTAAAAGGA No data
Right 993231904 5:85247562-85247584 AGTTTTCTGCAAAAGATGGCAGG No data
993231898_993231904 22 Left 993231898 5:85247517-85247539 CCAAAGCCCAGTAACAGGCCAAG 0: 169
1: 171
2: 103
3: 76
4: 232
Right 993231904 5:85247562-85247584 AGTTTTCTGCAAAAGATGGCAGG No data
993231899_993231904 16 Left 993231899 5:85247523-85247545 CCCAGTAACAGGCCAAGAGCTGT 0: 174
1: 194
2: 145
3: 123
4: 215
Right 993231904 5:85247562-85247584 AGTTTTCTGCAAAAGATGGCAGG No data
993231900_993231904 15 Left 993231900 5:85247524-85247546 CCAGTAACAGGCCAAGAGCTGTC 0: 162
1: 189
2: 129
3: 114
4: 178
Right 993231904 5:85247562-85247584 AGTTTTCTGCAAAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993231904 Original CRISPR AGTTTTCTGCAAAAGATGGC AGG Intergenic
No off target data available for this crispr