ID: 993234475

View in Genome Browser
Species Human (GRCh38)
Location 5:85286079-85286101
Sequence TAAAATGCACACATGCGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993234472_993234475 7 Left 993234472 5:85286049-85286071 CCTGTCAAATTATAATCACTAAA No data
Right 993234475 5:85286079-85286101 TAAAATGCACACATGCGGCTGGG No data
993234471_993234475 8 Left 993234471 5:85286048-85286070 CCCTGTCAAATTATAATCACTAA No data
Right 993234475 5:85286079-85286101 TAAAATGCACACATGCGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993234475 Original CRISPR TAAAATGCACACATGCGGCT GGG Intergenic
No off target data available for this crispr