ID: 993236081

View in Genome Browser
Species Human (GRCh38)
Location 5:85311870-85311892
Sequence GCGCAGGTTGCCAGACTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993236075_993236081 18 Left 993236075 5:85311829-85311851 CCATTGCCAGGCATGGGATTCAG No data
Right 993236081 5:85311870-85311892 GCGCAGGTTGCCAGACTGAGTGG No data
993236078_993236081 12 Left 993236078 5:85311835-85311857 CCAGGCATGGGATTCAGGCTGGT No data
Right 993236081 5:85311870-85311892 GCGCAGGTTGCCAGACTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993236081 Original CRISPR GCGCAGGTTGCCAGACTGAG TGG Intergenic
No off target data available for this crispr