ID: 993238767

View in Genome Browser
Species Human (GRCh38)
Location 5:85351752-85351774
Sequence CTTTCAACAATAGCAAGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993238767_993238769 20 Left 993238767 5:85351752-85351774 CCCTTTCTTGCTATTGTTGAAAG No data
Right 993238769 5:85351795-85351817 ATGATAGATGAGTATCTACGTGG No data
993238767_993238770 30 Left 993238767 5:85351752-85351774 CCCTTTCTTGCTATTGTTGAAAG No data
Right 993238770 5:85351805-85351827 AGTATCTACGTGGATGTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993238767 Original CRISPR CTTTCAACAATAGCAAGAAA GGG (reversed) Intergenic
No off target data available for this crispr