ID: 993238770

View in Genome Browser
Species Human (GRCh38)
Location 5:85351805-85351827
Sequence AGTATCTACGTGGATGTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993238768_993238770 29 Left 993238768 5:85351753-85351775 CCTTTCTTGCTATTGTTGAAAGA No data
Right 993238770 5:85351805-85351827 AGTATCTACGTGGATGTAACTGG No data
993238767_993238770 30 Left 993238767 5:85351752-85351774 CCCTTTCTTGCTATTGTTGAAAG No data
Right 993238770 5:85351805-85351827 AGTATCTACGTGGATGTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993238770 Original CRISPR AGTATCTACGTGGATGTAAC TGG Intergenic
No off target data available for this crispr