ID: 993248783

View in Genome Browser
Species Human (GRCh38)
Location 5:85487609-85487631
Sequence TTCCCTTTAGTCCATGATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993248783_993248788 9 Left 993248783 5:85487609-85487631 CCCACATCATGGACTAAAGGGAA No data
Right 993248788 5:85487641-85487663 AGTCCTTCACTCTTCTGGAAGGG No data
993248783_993248791 23 Left 993248783 5:85487609-85487631 CCCACATCATGGACTAAAGGGAA No data
Right 993248791 5:85487655-85487677 CTGGAAGGGCATCATTTGTTGGG No data
993248783_993248790 22 Left 993248783 5:85487609-85487631 CCCACATCATGGACTAAAGGGAA No data
Right 993248790 5:85487654-85487676 TCTGGAAGGGCATCATTTGTTGG No data
993248783_993248785 4 Left 993248783 5:85487609-85487631 CCCACATCATGGACTAAAGGGAA No data
Right 993248785 5:85487636-85487658 GCCAGAGTCCTTCACTCTTCTGG No data
993248783_993248787 8 Left 993248783 5:85487609-85487631 CCCACATCATGGACTAAAGGGAA No data
Right 993248787 5:85487640-85487662 GAGTCCTTCACTCTTCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993248783 Original CRISPR TTCCCTTTAGTCCATGATGT GGG (reversed) Intergenic
No off target data available for this crispr