ID: 993248784

View in Genome Browser
Species Human (GRCh38)
Location 5:85487610-85487632
Sequence GTTCCCTTTAGTCCATGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993248784_993248788 8 Left 993248784 5:85487610-85487632 CCACATCATGGACTAAAGGGAAC No data
Right 993248788 5:85487641-85487663 AGTCCTTCACTCTTCTGGAAGGG No data
993248784_993248787 7 Left 993248784 5:85487610-85487632 CCACATCATGGACTAAAGGGAAC No data
Right 993248787 5:85487640-85487662 GAGTCCTTCACTCTTCTGGAAGG No data
993248784_993248785 3 Left 993248784 5:85487610-85487632 CCACATCATGGACTAAAGGGAAC No data
Right 993248785 5:85487636-85487658 GCCAGAGTCCTTCACTCTTCTGG No data
993248784_993248791 22 Left 993248784 5:85487610-85487632 CCACATCATGGACTAAAGGGAAC No data
Right 993248791 5:85487655-85487677 CTGGAAGGGCATCATTTGTTGGG No data
993248784_993248790 21 Left 993248784 5:85487610-85487632 CCACATCATGGACTAAAGGGAAC No data
Right 993248790 5:85487654-85487676 TCTGGAAGGGCATCATTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993248784 Original CRISPR GTTCCCTTTAGTCCATGATG TGG (reversed) Intergenic
No off target data available for this crispr