ID: 993248786

View in Genome Browser
Species Human (GRCh38)
Location 5:85487637-85487659
Sequence TCCAGAAGAGTGAAGGACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993248786_993248794 25 Left 993248786 5:85487637-85487659 CCAGAGTCCTTCACTCTTCTGGA No data
Right 993248794 5:85487685-85487707 TCCATGGTTTGGAATAAAAGAGG 0: 8
1: 29
2: 32
3: 52
4: 208
993248786_993248792 9 Left 993248786 5:85487637-85487659 CCAGAGTCCTTCACTCTTCTGGA No data
Right 993248792 5:85487669-85487691 TTTGTTGGGTTCTTTTTCCATGG No data
993248786_993248793 14 Left 993248786 5:85487637-85487659 CCAGAGTCCTTCACTCTTCTGGA No data
Right 993248793 5:85487674-85487696 TGGGTTCTTTTTCCATGGTTTGG No data
993248786_993248790 -6 Left 993248786 5:85487637-85487659 CCAGAGTCCTTCACTCTTCTGGA No data
Right 993248790 5:85487654-85487676 TCTGGAAGGGCATCATTTGTTGG No data
993248786_993248791 -5 Left 993248786 5:85487637-85487659 CCAGAGTCCTTCACTCTTCTGGA No data
Right 993248791 5:85487655-85487677 CTGGAAGGGCATCATTTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993248786 Original CRISPR TCCAGAAGAGTGAAGGACTC TGG (reversed) Intergenic
No off target data available for this crispr