ID: 993248789

View in Genome Browser
Species Human (GRCh38)
Location 5:85487644-85487666
Sequence ATGCCCTTCCAGAAGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993248789_993248793 7 Left 993248789 5:85487644-85487666 CCTTCACTCTTCTGGAAGGGCAT No data
Right 993248793 5:85487674-85487696 TGGGTTCTTTTTCCATGGTTTGG No data
993248789_993248794 18 Left 993248789 5:85487644-85487666 CCTTCACTCTTCTGGAAGGGCAT No data
Right 993248794 5:85487685-85487707 TCCATGGTTTGGAATAAAAGAGG 0: 8
1: 29
2: 32
3: 52
4: 208
993248789_993248792 2 Left 993248789 5:85487644-85487666 CCTTCACTCTTCTGGAAGGGCAT No data
Right 993248792 5:85487669-85487691 TTTGTTGGGTTCTTTTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993248789 Original CRISPR ATGCCCTTCCAGAAGAGTGA AGG (reversed) Intergenic
No off target data available for this crispr