ID: 993248790

View in Genome Browser
Species Human (GRCh38)
Location 5:85487654-85487676
Sequence TCTGGAAGGGCATCATTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993248780_993248790 30 Left 993248780 5:85487601-85487623 CCTCTCAACCCACATCATGGACT No data
Right 993248790 5:85487654-85487676 TCTGGAAGGGCATCATTTGTTGG No data
993248786_993248790 -6 Left 993248786 5:85487637-85487659 CCAGAGTCCTTCACTCTTCTGGA No data
Right 993248790 5:85487654-85487676 TCTGGAAGGGCATCATTTGTTGG No data
993248783_993248790 22 Left 993248783 5:85487609-85487631 CCCACATCATGGACTAAAGGGAA No data
Right 993248790 5:85487654-85487676 TCTGGAAGGGCATCATTTGTTGG No data
993248784_993248790 21 Left 993248784 5:85487610-85487632 CCACATCATGGACTAAAGGGAAC No data
Right 993248790 5:85487654-85487676 TCTGGAAGGGCATCATTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993248790 Original CRISPR TCTGGAAGGGCATCATTTGT TGG Intergenic
No off target data available for this crispr