ID: 993248791

View in Genome Browser
Species Human (GRCh38)
Location 5:85487655-85487677
Sequence CTGGAAGGGCATCATTTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993248783_993248791 23 Left 993248783 5:85487609-85487631 CCCACATCATGGACTAAAGGGAA No data
Right 993248791 5:85487655-85487677 CTGGAAGGGCATCATTTGTTGGG No data
993248786_993248791 -5 Left 993248786 5:85487637-85487659 CCAGAGTCCTTCACTCTTCTGGA No data
Right 993248791 5:85487655-85487677 CTGGAAGGGCATCATTTGTTGGG No data
993248784_993248791 22 Left 993248784 5:85487610-85487632 CCACATCATGGACTAAAGGGAAC No data
Right 993248791 5:85487655-85487677 CTGGAAGGGCATCATTTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993248791 Original CRISPR CTGGAAGGGCATCATTTGTT GGG Intergenic
No off target data available for this crispr