ID: 993248793

View in Genome Browser
Species Human (GRCh38)
Location 5:85487674-85487696
Sequence TGGGTTCTTTTTCCATGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993248789_993248793 7 Left 993248789 5:85487644-85487666 CCTTCACTCTTCTGGAAGGGCAT No data
Right 993248793 5:85487674-85487696 TGGGTTCTTTTTCCATGGTTTGG No data
993248786_993248793 14 Left 993248786 5:85487637-85487659 CCAGAGTCCTTCACTCTTCTGGA No data
Right 993248793 5:85487674-85487696 TGGGTTCTTTTTCCATGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993248793 Original CRISPR TGGGTTCTTTTTCCATGGTT TGG Intergenic
No off target data available for this crispr