ID: 993248794

View in Genome Browser
Species Human (GRCh38)
Location 5:85487685-85487707
Sequence TCCATGGTTTGGAATAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 8, 1: 29, 2: 32, 3: 52, 4: 208}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993248786_993248794 25 Left 993248786 5:85487637-85487659 CCAGAGTCCTTCACTCTTCTGGA No data
Right 993248794 5:85487685-85487707 TCCATGGTTTGGAATAAAAGAGG 0: 8
1: 29
2: 32
3: 52
4: 208
993248789_993248794 18 Left 993248789 5:85487644-85487666 CCTTCACTCTTCTGGAAGGGCAT No data
Right 993248794 5:85487685-85487707 TCCATGGTTTGGAATAAAAGAGG 0: 8
1: 29
2: 32
3: 52
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993248794 Original CRISPR TCCATGGTTTGGAATAAAAG AGG Intergenic
904877602 1:33668418-33668440 TCAAAGGTTTATAATAAAAGGGG - Intronic
905249358 1:36638109-36638131 CCCAGGGTTTGGAAGAGAAGGGG - Intergenic
906421569 1:45672637-45672659 TCCATGGATTTAAATAAAATTGG - Intronic
907211825 1:52830293-52830315 TCCATGGTTTAGAATAAAAGAGG - Intergenic
907709653 1:56867501-56867523 AACATGGTTTGGAAGAAATGAGG - Intronic
908085432 1:60627199-60627221 TGCATGATTTGCAATAGAAGTGG - Intergenic
908466436 1:64400946-64400968 TCCATGGGGTGGAGAAAAAGGGG - Intergenic
908732633 1:67242109-67242131 TCCATAGTTTGAAGTAAAAGAGG - Intronic
908934539 1:69358544-69358566 TCCATGATTTGGAATAAAAGAGG - Intergenic
909209973 1:72810659-72810681 TCCATGGTTTAGAATAAAAGAGG - Intergenic
909315787 1:74216525-74216547 TCTTTGGTTTGGGATAAAGGAGG + Intronic
909576130 1:77178336-77178358 TCCATGGTTTGGAGTAAAAACGG + Intronic
910243803 1:85117538-85117560 TGTTTGGTTTGGAACAAAAGAGG + Intronic
910303783 1:85738707-85738729 TCTTTGCTATGGAATAAAAGTGG - Intronic
911445016 1:97981700-97981722 TACATGGTTTGGACAAATAGTGG + Intergenic
913084490 1:115424241-115424263 TCCATGGTTGGGATCAAAAGAGG + Intergenic
914898356 1:151697001-151697023 TGCATGGTATGGGATCAAAGAGG + Exonic
916035197 1:160915828-160915850 TCCATGGTTTGGAGTAAAAGAGG - Intergenic
919312673 1:195930955-195930977 TAGTTGGTTTGGAATAAAGGTGG - Intergenic
919328844 1:196143191-196143213 TCCATTTATTTGAATAAAAGTGG + Intergenic
920016598 1:202915559-202915581 TACAGGCTTTGGAATAAAACTGG - Intronic
920157268 1:203964281-203964303 TCCATGGTTTGGAATAAAAGAGG - Intergenic
921305237 1:213789952-213789974 TCAATGGTTTGTAACGAAAGAGG + Intergenic
922089831 1:222385193-222385215 TGCATGGTTTGGAATGGATGAGG + Intergenic
922158344 1:223058284-223058306 TCCATGTTTTTGAATAAAAGAGG - Intergenic
922759015 1:228113517-228113539 TCCATCGTTTAGAATAAAATAGG - Intergenic
923244050 1:232113769-232113791 TCAGTGGGTTGGAAGAAAAGAGG - Intergenic
924100237 1:240595523-240595545 TCCATAATTTGGAATATAACTGG - Intronic
1063228090 10:4034773-4034795 TCCAAGTTTTTGAATTAAAGGGG - Intergenic
1065129372 10:22604989-22605011 TACTTGGTTTGGAAGAAAGGAGG - Intronic
1065807213 10:29405283-29405305 TCCATGGTTTAGAATAAAAGAGG - Intergenic
1067422063 10:46160538-46160560 TCCATAGTTTGGAATAAAAGCGG + Intergenic
1067507370 10:46866627-46866649 TCCATAGTTTGGAATAAAAGCGG + Intergenic
1067680837 10:48439428-48439450 TCCGTGGATTGGGATAAAAGGGG + Intergenic
1070191582 10:74116286-74116308 CCCATGGTTTGGGAGAAGAGAGG - Intronic
1071673154 10:87630409-87630431 TCCATGGTTTAAAGTAAATGAGG + Intergenic
1072004385 10:91229794-91229816 AACATGTTTTGGAATAAAAAAGG + Intronic
1072711304 10:97717361-97717383 TGCATGGTTTGGAAAGGAAGGGG - Exonic
1075899173 10:126025134-126025156 GCCATGATTTGGAGAAAAAGTGG - Intronic
1077312779 11:1898558-1898580 TCCATGGTTTGGAGTAAATGAGG - Intergenic
1078311815 11:10251301-10251323 TCCATGATTTAGAATAAAAGAGG + Intronic
1078672790 11:13379695-13379717 GCCAGGGTTTGCAATAAGAGTGG + Intronic
1078868084 11:15317025-15317047 TCCATGGTATCAAATAAATGTGG + Intergenic
1079074274 11:17373962-17373984 TCTCTGGTTAGGAAAAAAAGTGG - Exonic
1079128388 11:17734453-17734475 TCCCTGGTTTGGAAGGCAAGGGG + Intergenic
1079151782 11:17906321-17906343 TCCATGGTTTAGAATACCAGTGG + Intronic
1079813873 11:25030553-25030575 TACATGGAATGGAATAAGAGTGG - Intronic
1080810000 11:35694258-35694280 TCCATGATTTGGAATAAAAAAGG - Intronic
1081845627 11:46238440-46238462 TCCAGAGTTTGGAATGAACGAGG - Intergenic
1082698360 11:56398682-56398704 TCCATGGTTTAGAATAAAAAAGG - Intergenic
1083861659 11:65423280-65423302 CCCTTGGTCTGGAAAAAAAGGGG - Intergenic
1084878222 11:72149833-72149855 TCCAGGGTCTGGTATAAAATGGG + Intergenic
1085146412 11:74202185-74202207 TACATGATTTGGAATGACAGAGG - Intronic
1086590857 11:88511908-88511930 TCCATGCTTTGTATTAAAAGGGG - Intronic
1087226899 11:95611381-95611403 TTCATGGTTTAGAATAAAATAGG - Intergenic
1087524699 11:99295476-99295498 TCCATGGTTTAGAATAAAAGTGG - Intronic
1088143227 11:106643734-106643756 TCCATGGCTTGGAGTAAATGAGG + Intergenic
1088415891 11:109588817-109588839 CACATGGTTTGGGAGAAAAGAGG - Intergenic
1090292890 11:125561371-125561393 TCGACGGTTTGGAGTAAAAGAGG + Intergenic
1091068587 11:132541896-132541918 TGCAAGGTTTGGAACAGAAGTGG + Intronic
1094239586 12:28206845-28206867 TCCACGGTTTGGAATAAAAGAGG - Intronic
1095184122 12:39180963-39180985 TCCACAGGTAGGAATAAAAGTGG + Intergenic
1097254582 12:57663951-57663973 TCCATGGTTTAGAATAAGAGAGG + Intergenic
1097778595 12:63676665-63676687 TCCATGGTTTGGGGGGAAAGAGG - Intergenic
1098294422 12:68990029-68990051 TCCATGATTTGGAATAAAAGAGG + Intergenic
1098502568 12:71210546-71210568 TCCATGGTTTAAAATAAAAGAGG + Intronic
1098655762 12:73027525-73027547 TCCATGGTTATGAAAACAAGTGG + Intergenic
1098711977 12:73774237-73774259 TTTATGGTTTGGAATAATTGTGG + Intergenic
1099799051 12:87434012-87434034 GTCATGGTTTGGAGTAAATGAGG + Intergenic
1101167081 12:102049450-102049472 GCTATGGTTTGGGATAACAGGGG + Intronic
1101189413 12:102315902-102315924 TCCATGGTTTAGAATACAAGAGG + Intergenic
1102073956 12:110045205-110045227 TCTATGGTTTGGACTACAATTGG + Intronic
1105034950 12:132912223-132912245 ACCATCGTTAGGAATAAAAAGGG - Intronic
1107255473 13:38421040-38421062 TCCATAGTTTGGAGTAAATAAGG - Intergenic
1108265539 13:48704077-48704099 TCCATTGTCAGGAATAAAACAGG - Intronic
1108336753 13:49450717-49450739 TCCATGGTTTGGTGTGGAAGTGG + Intronic
1109345985 13:61114800-61114822 TCCAGGATTTGGTATAAAAAAGG + Intergenic
1109970600 13:69763061-69763083 TCCATGATTTGGAATAAATGAGG + Intronic
1110050162 13:70886959-70886981 TCCATGGTTTACAATAAAAGAGG + Intergenic
1110250106 13:73371911-73371933 TCAAGGGTTTGGAATAAGTGAGG - Intergenic
1110643995 13:77859913-77859935 TCCAAGGTTTGAAAAAAAACAGG - Intergenic
1110957146 13:81568427-81568449 TCAACAGCTTGGAATAAAAGAGG + Intergenic
1112103089 13:96211349-96211371 GCCATGGTTTGGAGTCAGAGTGG - Intronic
1113968449 13:114168807-114168829 TCCATTGTTTGGAGTAAAAGAGG - Intergenic
1114335126 14:21681203-21681225 TCTGTGGTTTGAAGTAAAAGAGG + Intergenic
1115533396 14:34347342-34347364 TCCATAGTTTGGAGTAAATGAGG - Intronic
1115634149 14:35275277-35275299 TATATGGTTTGATATAAAAGAGG - Intronic
1115907844 14:38221151-38221173 CCCATGGTTTGGAGTAAATGAGG - Intergenic
1116110971 14:40580756-40580778 TGAATGGTTTTGAATAAAATTGG - Intergenic
1116310343 14:43317505-43317527 CCCATGGTTAGGAGTAAATGAGG + Intergenic
1116361124 14:43999432-43999454 TCCAGGGTATGGAATAGAAAGGG + Intergenic
1116679311 14:47945596-47945618 TCCATGGTTTAGAATAAAAGAGG + Intergenic
1116725620 14:48558350-48558372 TCCATGGTTTAAAGTAAAAGAGG - Intergenic
1117084353 14:52183662-52183684 AGCATTGTGTGGAATAAAAGTGG - Intergenic
1118117525 14:62797223-62797245 TGCAGGTTTTGGAATAAAATAGG - Intronic
1118691933 14:68348476-68348498 TTGATGGTTTGAAATAAAATTGG + Intronic
1120649797 14:87118480-87118502 TCCATGGTTTGGAGTAAATGAGG + Intergenic
1122289321 14:100671443-100671465 TCCAGGTTTTGAAATAATAGAGG - Intergenic
1124039664 15:26089311-26089333 TCCATGGTTTCGAGTAAAAAAGG - Intergenic
1124260326 15:28183786-28183808 TTCATGTTTTGGAATAAAAGTGG + Intronic
1125649024 15:41298139-41298161 TCCATGATTTGGAATGGAAAAGG + Intergenic
1128188962 15:65672269-65672291 TTCATGATTTGAAATAAAAATGG - Intronic
1131392874 15:92063286-92063308 TCCAGGGTTTGGACTGAAATGGG - Intronic
1131484806 15:92810845-92810867 TCCATCGTTTGGCAAAGAAGCGG + Intergenic
1131952263 15:97693544-97693566 TCCATTGTTTGGAGTAGGAGTGG + Intergenic
1133077374 16:3290182-3290204 TCCATGGTTTGTAAGAAAGGGGG - Exonic
1146108618 17:30066153-30066175 TCCATGGGCTGAAAAAAAAGAGG - Intronic
1148797606 17:50204564-50204586 TCCATGGTATGGGACAAAGGAGG + Intergenic
1148832051 17:50440153-50440175 TCCATGGCTTGGAACAAAACAGG + Intronic
1148981770 17:51582949-51582971 TCCATGTTTTTGAAAATAAGAGG + Intergenic
1153118166 18:1686475-1686497 TTCATCGTTTGGAGTAAAAGAGG - Intergenic
1153461735 18:5341866-5341888 TCTATGGTCTGGAAATAAAGAGG + Intergenic
1154036952 18:10812544-10812566 TCCATGCTTTGTGATGAAAGAGG + Intronic
1154365687 18:13706622-13706644 TTCACGGTTTGGAATAAAAGAGG + Intronic
1156570426 18:38246074-38246096 TCCAAGGTTTGGTATATGAGGGG - Intergenic
1157931115 18:51824525-51824547 TCTATTGTTTGGAATGGAAGTGG + Intergenic
1158370467 18:56796798-56796820 TCCATGGCATGGAAGAAAAAAGG + Intronic
1159768269 18:72517079-72517101 TCCAGGGTTTGGATTTAAATTGG + Intergenic
1160141063 18:76323529-76323551 TCCACGGTTTGGATAAACAGAGG + Intergenic
1163992833 19:21015065-21015087 CCCATGGTTTAGAGTAAATGAGG + Intergenic
1164071396 19:21772071-21772093 CCCATGGTTTAGAGTAAATGAGG - Intergenic
1164537947 19:29100369-29100391 TCCATCCTTTTGAAGAAAAGGGG + Intergenic
1168614034 19:57823363-57823385 TCCATGGTTTACAATAGCAGTGG - Intronic
1168618052 19:57854368-57854390 TCCATGGTTTACAATAGCAGTGG - Intronic
1168625293 19:57913280-57913302 TCCATGGTTTACAATAGCAGTGG + Intronic
925479361 2:4252876-4252898 TCCATGGTTTGGCTTAAAGAAGG + Intergenic
926405210 2:12544715-12544737 TCCTTGGTTATGAAGAAAAGAGG + Intergenic
927050158 2:19320180-19320202 TCCAGGGTTTGGATGAAATGTGG + Intergenic
927791522 2:26013743-26013765 TGAATGGTCTGGAAGAAAAGAGG + Intergenic
928951127 2:36813841-36813863 TTCATGTTTGGGAATAGAAGAGG - Intronic
928997873 2:37314714-37314736 TCTATGGTTTCAAATAAAAAGGG + Intronic
929153505 2:38769368-38769390 TTCATGGTTTGAAAAGAAAGGGG - Intronic
929308079 2:40388667-40388689 TCCAAGCTTCTGAATAAAAGAGG - Intronic
931589815 2:63870588-63870610 TCCTTAGTTTAAAATAAAAGTGG - Intronic
931596966 2:63957758-63957780 TTCATGATTTGTAATTAAAGTGG - Intronic
932445590 2:71779146-71779168 TCTGGGGCTTGGAATAAAAGGGG - Intergenic
933077736 2:77950861-77950883 TCCATGGTTTAAAGTAGAAGAGG - Intergenic
933736253 2:85497110-85497132 TCCATGATTTGGGGTAAATGAGG + Intergenic
933838544 2:86266048-86266070 TCCATGGTTAGGAGAAAAATTGG + Intronic
934013810 2:87855994-87856016 TCCATTGTTTGGAATTAATGTGG + Intergenic
935175430 2:100644621-100644643 TCCCTGCTTTGTTATAAAAGAGG + Intergenic
935275420 2:101472028-101472050 TCCAGGCTTTGGAATACCAGAGG + Intronic
937674894 2:124579213-124579235 ACCATGATTTGGAGTAAATGAGG + Intronic
938957417 2:136311481-136311503 TCCATGGAATGAAAGAAAAGGGG + Intergenic
939493366 2:142901952-142901974 TTCATTGTTTGGAAGAAATGTGG + Intronic
941293555 2:163707081-163707103 TGAATGTTTTGAAATAAAAGAGG - Intronic
942929140 2:181468939-181468961 TACATGGTTTAACATAAAAGAGG - Intronic
943969133 2:194380785-194380807 TCCATCGTTTGGAGTAAAAGAGG - Intergenic
944358422 2:198821648-198821670 ACAATAGTTTGGAATGAAAGAGG + Intergenic
946296845 2:218791159-218791181 TCCATGGTTTGGAGTAAATGAGG - Intronic
1169247850 20:4037947-4037969 TCCAGGGTTCAGAATAAAAGGGG + Intergenic
1170484242 20:16799967-16799989 TCCATCATTTGGATAAAAAGTGG + Intergenic
1171318499 20:24217879-24217901 TCCATGGTTTGGAGTAAAAGAGG - Intergenic
1171565756 20:26184947-26184969 TTCATAGTTTGTAATAAAAATGG - Intergenic
1171721766 20:28570341-28570363 TCCATGGTTTAGAATATAAGAGG + Intergenic
1171756296 20:29113158-29113180 TCCATGGTTTAGAATAAAAGAGG - Intergenic
1171785957 20:29464735-29464757 TCCATGGTTTAGAATAAAAGAGG + Intergenic
1171862283 20:30412237-30412259 TCCATGGTTTAGAATAAAGGAGG - Intergenic
1173198481 20:40935999-40936021 TCCAGGGGTTGGAAGAAGAGGGG + Intergenic
1173490778 20:43479405-43479427 TCTATGGTTTGGAGTAAATGAGG - Intergenic
1173694594 20:44998022-44998044 CCCCTGCTTTGGAATAAAAAAGG - Intronic
1174772056 20:53309345-53309367 TGCATGCTTTGGTATAGAAGTGG - Intronic
1177193217 21:17874691-17874713 GCCATCGTTTGGGAAAAAAGTGG - Intergenic
1177225602 21:18250022-18250044 TCCATGCTTTGGGATAAATTGGG - Intronic
1177326850 21:19601812-19601834 CCCATGGTTTGGAGTAAATTAGG - Intergenic
1177501461 21:21961869-21961891 TAAATGGTTTGAAATTAAAGAGG + Intergenic
1178435437 21:32554085-32554107 TCCATGGTTTGGTACAACATTGG + Intergenic
1180295321 22:10929028-10929050 TCCATGGTTTAGAATAAAAGAGG + Intergenic
1180413350 22:12637016-12637038 TCCATGGTTTAGAATAAAAGAGG - Intergenic
1180592825 22:16955560-16955582 ACCTTGGTTTGGAAAATAAGCGG - Intergenic
1180617365 22:17137273-17137295 TCCCTGGTGTGGAAAAGAAGAGG - Intergenic
1181453728 22:23041371-23041393 TCCATGGTTTGGAGTAAATGAGG - Intergenic
1181868922 22:25882433-25882455 TCCATGGATTCTCATAAAAGGGG + Intronic
1183643426 22:39107392-39107414 TCCATAGTTTAGAATAAAAGTGG + Intergenic
1184618704 22:45656666-45656688 TGCATGGTTTGGAGTAAATGAGG + Intergenic
950017111 3:9762014-9762036 TCCAGGGTCTGGCATAAAATAGG - Intronic
950604776 3:14068891-14068913 TCCATGGTTTAGAATAAAAGAGG - Intronic
951250340 3:20386994-20387016 TCCATGGTTTAGAATAAAAGAGG + Intergenic
953631031 3:44617831-44617853 TCCATGGGCAGGAAAAAAAGAGG + Intronic
954644357 3:52121926-52121948 TCCATGGTTAGAAAAAAAAAGGG + Intronic
955046368 3:55364329-55364351 TGCATGGAATGGAATAAAAGGGG - Intergenic
955535912 3:59923628-59923650 CCCACGGTTTGTAATAAAAGTGG - Intronic
956723638 3:72139175-72139197 TCCATGGGTGGGAATAGAGGGGG + Intergenic
957603442 3:82368549-82368571 TCCATGGTTTAGAATAAAAGAGG - Intergenic
957724802 3:84050042-84050064 TCCATAGTTTAGTATAAAAGAGG + Intergenic
957750869 3:84413574-84413596 TCCATGGATTGGAATAAAGGAGG + Intergenic
961344515 3:126254977-126254999 TCCATGGTTTGAAGTAAATTAGG + Intergenic
961596269 3:128020242-128020264 TCCATGGTTTGGAATAAAAGAGG + Intergenic
962246082 3:133794953-133794975 TCCATGATTTGGAATAAAAGAGG + Intronic
965278678 3:166720645-166720667 TCCATGATTTGGAGTAAAAGAGG - Intergenic
966536203 3:181037111-181037133 TTCATGGTTCAGAATAAAAGAGG - Intergenic
966670114 3:182517036-182517058 TTTATGGTTAAGAATAAAAGCGG - Intergenic
966831715 3:184016102-184016124 TTCATCCTTTGAAATAAAAGTGG - Intronic
968846956 4:3048803-3048825 TCCATGGTTTAGAGTAAAAGAGG - Intergenic
970429662 4:15977088-15977110 GCCATGGTTGTGAAAAAAAGGGG - Intronic
971423149 4:26492058-26492080 TTCATGGTTTCAAAGAAAAGAGG - Intergenic
971719651 4:30229266-30229288 TCCATGGTTTGGAATAAAAGAGG - Intergenic
972664117 4:41147364-41147386 ACCAAGGTTTTGAATAAAAAAGG - Intronic
973035300 4:45398123-45398145 TCCATGGTTTGGAGTAAATGAGG - Intergenic
973216037 4:47670541-47670563 TCCTTGGTGTTGAATAAGAGGGG + Intronic
973813869 4:54600209-54600231 TCCATGGTTTAGAATAAAATAGG - Intergenic
973847355 4:54926778-54926800 GCCATAGTTTGTAATAAAAAAGG - Intergenic
973946196 4:55958752-55958774 TCCATGGGGTGGAGTAAATGAGG - Intronic
974385022 4:61192956-61192978 TTAATGGTTTGGAATCAACGGGG - Intergenic
976270302 4:83223791-83223813 TCCATGGTCAGGAACAAAGGCGG + Intergenic
977838890 4:101677058-101677080 TCCATTATTTGGAGAAAAAGAGG + Intronic
978966114 4:114743801-114743823 TCCATGGTTTATAGTAAATGAGG + Intergenic
979702025 4:123680142-123680164 TCTATGTTTTGGAAAAAGAGAGG + Intergenic
980637940 4:135534162-135534184 TACATAGTTTGGAATAGATGTGG - Intergenic
980777632 4:137457518-137457540 TCCATGGTATATAATAAAACTGG - Intergenic
980934506 4:139213534-139213556 TCCATAGTGTGGAATAACATGGG - Intergenic
981201308 4:141982847-141982869 TCCATAGTTTAGAGTAAAAGAGG + Intergenic
983731541 4:171000048-171000070 GCCATGATATAGAATAAAAGTGG - Intergenic
984175737 4:176414213-176414235 TCCAGGGATTGGAATAAAGCTGG + Intergenic
984664587 4:182411915-182411937 TCCATGGCTAGGAATAAACCAGG + Intronic
984744999 4:183206481-183206503 TACATGTTTTAAAATAAAAGTGG - Intronic
987533728 5:19156623-19156645 TACATGGTTTGCAGAAAAAGGGG - Intergenic
988505669 5:31820353-31820375 TCCATGTTTTTACATAAAAGTGG + Intronic
989093653 5:37760296-37760318 TTCATGGTTTGGAGTAAATGGGG - Intergenic
989598922 5:43183700-43183722 TCCATAGTTTAGAGTAAAAAAGG - Intronic
990082007 5:51928521-51928543 TCCATGGTTTGGAATAAAAGAGG + Intergenic
993248794 5:85487685-85487707 TCCATGGTTTGGAATAAAAGAGG + Intergenic
994467659 5:100159002-100159024 TTCATTGTTTGGAGTAAAAGAGG - Intergenic
996970716 5:129364180-129364202 TGCATGGTATGGAATGAAGGAGG - Intergenic
997142574 5:131398318-131398340 ACTGTGGTCTGGAATAAAAGGGG + Intronic
998274514 5:140739689-140739711 TCCATGGTTAGAAAAAGAAGGGG - Intergenic
998547337 5:143041262-143041284 TCCTTGGGTTGAAATAAAGGTGG + Intronic
999147260 5:149404812-149404834 TTCTTGGTTTGGAAAAGAAGGGG + Intergenic
999296783 5:150464692-150464714 TCCCTGGTTAGGCAAAAAAGAGG + Intergenic
1001968024 5:175927211-175927233 TCCATGGCTTGGAATGGAAAAGG + Intronic
1002249419 5:177916595-177916617 TCCATGGCTTGGAATGGAAAAGG - Intergenic
1002665339 5:180819544-180819566 TCATTTATTTGGAATAAAAGAGG + Intergenic
1002895365 6:1376965-1376987 CCCATGTTTTGGAACAAAATGGG - Intergenic
1003926980 6:10885796-10885818 TCCTTGGTTTAGATTAAAATAGG + Intronic
1004056945 6:12148742-12148764 ATCACTGTTTGGAATAAAAGAGG - Intronic
1004633978 6:17449229-17449251 CCCATGGTATGGAATTTAAGAGG - Intronic
1004765937 6:18726815-18726837 TCTATGGTATGGAATTAAAGAGG + Intergenic
1005133254 6:22536892-22536914 TCCATTGTTTGAATTAAAAGGGG + Intergenic
1006290665 6:33133627-33133649 ACCATGATTTGGAGTAAAACAGG - Intergenic
1006819795 6:36883758-36883780 TCCATGGTTTAGAATAAAAGAGG + Intronic
1009405235 6:63304301-63304323 TCTATGGCTTGGAGTAAATGAGG + Intronic
1011153251 6:84299119-84299141 TCCATGGATTGGAGTAAATGAGG + Intergenic
1011341870 6:86324868-86324890 TCCATAGTTTGGAGTAAAAGAGG + Intergenic
1011357286 6:86485031-86485053 TTCATGATTTGGAGTAAATGAGG + Intergenic
1011510478 6:88094819-88094841 TCCAAGGTCAGGAATAAAAGAGG - Intergenic
1012393355 6:98768378-98768400 TCCCTTGTGTGGAATAAATGAGG - Intergenic
1014162939 6:118191047-118191069 TCCATGGTTTGGAATAAAAGAGG - Intronic
1014241662 6:119024815-119024837 TGCATGGTTTTGAATAAGAAGGG + Intronic
1014466760 6:121765250-121765272 TCAATAGTTTGGAATGCAAGTGG + Intergenic
1014947208 6:127513662-127513684 TCTAGGGTTTGGAAGAAAAGTGG + Intronic
1016006652 6:139095646-139095668 TCAATGCTTTAGAATCAAAGGGG - Intergenic
1016019577 6:139221744-139221766 TCAATGGATTGGTATAACAGTGG + Intergenic
1017272749 6:152528130-152528152 GCCATGGTTAGGAAGAAGAGAGG - Intronic
1017386447 6:153890267-153890289 TCTATGGTTTGCATTAAATGAGG + Intergenic
1017983869 6:159425524-159425546 TCCATGGTTTGGGATCACCGAGG - Intergenic
1018138540 6:160803409-160803431 TCCATGTATTGGAGTAAATGAGG + Intergenic
1018266792 6:162033061-162033083 GCCAGTGTCTGGAATAAAAGAGG - Intronic
1019270795 7:147236-147258 TCCATGGTTTGGAATTAAAAAGG - Intergenic
1020364381 7:7364833-7364855 TCTATGCTATGGAAAAAAAGAGG - Intronic
1022744776 7:33160208-33160230 TCCATGGTTTGAAGTAAATGAGG - Intronic
1024997346 7:55282414-55282436 TTCATGGTTTAGAGTAAAAGAGG - Intergenic
1025864617 7:65369312-65369334 CCCATGGTTTAGAGTAAATGAGG + Intergenic
1028400586 7:90421211-90421233 TCCTTGGTTGGGAATAAAAGAGG + Intronic
1029810793 7:103046380-103046402 TCCATGGTTTAGAATAAAAGAGG - Intronic
1029900253 7:104031716-104031738 TTCATGATTTGGAGTAAATGAGG - Intergenic
1030180868 7:106707713-106707735 TCCATTGTTGAGAATAAAACAGG - Intergenic
1031218258 7:118926550-118926572 TCTATAGTTTGGATTAAATGAGG + Intergenic
1031305391 7:120119705-120119727 TCCATGGTTTAGAATAAAAGAGG + Intergenic
1031534441 7:122916096-122916118 TCCATGCTTTGTAAGAAAAAAGG - Intergenic
1031742509 7:125452642-125452664 TCCATGATTTAGAATAAAAGAGG - Intergenic
1032146673 7:129388989-129389011 TCCATGGTTTGGAATTTTAGAGG + Intronic
1033850003 7:145483397-145483419 TCCATGGTTTAAAGTAAAAGAGG - Intergenic
1034142655 7:148836701-148836723 TCAATGGTTTAAAAAAAAAGGGG + Intronic
1035567499 8:651221-651243 TCCAGGGTTGGGAAGAGAAGTGG + Intronic
1038603020 8:28967311-28967333 TTTATGACTTGGAATAAAAGTGG + Intronic
1040089387 8:43381431-43381453 TCCATGGTTTGAAGTACAAGAGG - Intergenic
1040385224 8:46910745-46910767 TACATACTTTGGAGTAAAAGTGG - Intergenic
1040402726 8:47068517-47068539 CCCATGGTTTAAAGTAAAAGAGG + Intergenic
1041566647 8:59286138-59286160 TCCATGACTTGGAAAAAAAGAGG - Intergenic
1042355389 8:67822412-67822434 TTCATTGTTTTGAACAAAAGTGG - Intergenic
1042666391 8:71211206-71211228 TCAAAGGTTTGGAAGAAAAGTGG - Exonic
1043137334 8:76544683-76544705 TCCATGGCTTGGAGTAAATGAGG + Intergenic
1044342893 8:91068373-91068395 TCCAATGTTTGGAAAAGAAGTGG - Intergenic
1044510528 8:93073056-93073078 TCTATAGTTAGGAATAAAATTGG - Intergenic
1045231902 8:100313857-100313879 TGCATGGAATGGAATAAAAGTGG + Intronic
1045255420 8:100516250-100516272 TCCATAGTTTAGAATAATATCGG + Intronic
1046202577 8:110946817-110946839 TCCATGGTTTGGAATAAAAGGGG - Intergenic
1046325572 8:112640418-112640440 TCCATTGTTTTAAAAAAAAGGGG + Intronic
1046579370 8:116072642-116072664 TCCAAAGTTTGGAATAACAGAGG + Intergenic
1047367423 8:124224140-124224162 TACATGGTTTTGAATAAGATTGG - Intergenic
1048173172 8:132128043-132128065 AGCATGTTTTGCAATAAAAGTGG + Exonic
1050010819 9:1184319-1184341 TCCATGGTTTGGAATGAGTCAGG + Intergenic
1050159390 9:2701365-2701387 TCCATGGTCCGGAATACAAATGG - Intergenic
1050401236 9:5257952-5257974 TCTGTGGTTTCGAATAAAAGAGG - Intergenic
1050658089 9:7851565-7851587 TCCATGGTTTAGAATAAAACAGG + Intronic
1050802335 9:9630688-9630710 TCCACTATTTGGAATATAAGAGG - Intronic
1052075753 9:24137874-24137896 TCCAGGGTTATGAATAAAAGAGG + Intergenic
1052178593 9:25496924-25496946 TCAAGAGTTTAGAATAAAAGAGG + Intergenic
1052479151 9:28999707-28999729 TCCATGGTTAGGAAAAAATAGGG + Intergenic
1052606243 9:30705961-30705983 TCCTTGCTTTGAAAAAAAAGAGG - Intergenic
1053306992 9:36991703-36991725 TCCAGGGTTAGGAACAAGAGGGG - Intronic
1056430311 9:86520937-86520959 TCCACGGTTTGGAATAAAAGAGG + Intergenic
1057781144 9:98051561-98051583 TCTATGGTTTGGAGTAAAAGGGG - Intergenic
1058098612 9:100892199-100892221 GCCATGGTTTGGAGTAAATGAGG + Intergenic
1060018517 9:120108125-120108147 TTTAGGGGTTGGAATAAAAGAGG + Intergenic
1060114163 9:120927892-120927914 CCCCTGGTTTGGGATAAAACAGG + Exonic
1060616706 9:125023148-125023170 TCGATGTTTTAGAATACAAGGGG + Intronic
1202802198 9_KI270720v1_random:10132-10154 TCCATGGTTTAGAATAAAAGAGG + Intergenic
1203446757 Un_GL000219v1:63903-63925 TCCATGGTTTAGAATAAAAGAGG + Intergenic
1186893400 X:13982413-13982435 TCCATGGTTTGGAATAAAAGAGG + Intergenic
1188174172 X:26967405-26967427 TCAATGGTTTGAAATATCAGTGG + Intergenic
1188383442 X:29527164-29527186 TAAATGGTTTCGTATAAAAGAGG + Intronic
1188552208 X:31376703-31376725 TGCAAAATTTGGAATAAAAGGGG + Intronic
1188803082 X:34555580-34555602 TCCATGGTTTGGAGTAAAAGAGG + Intergenic
1189001636 X:36954048-36954070 CCCATGGTTTAGAGTAAATGAGG + Intergenic
1190058007 X:47193352-47193374 CCAGTGGGTTGGAATAAAAGGGG - Intronic
1193477012 X:81978754-81978776 TCTATGATTTGGAGTAAAACAGG + Intergenic
1193695696 X:84705178-84705200 TCCATAGTTTGGAGTAAATGAGG - Intergenic
1193892636 X:87069305-87069327 TCCATTGTTTTACATAAAAGGGG - Intergenic
1193958733 X:87896874-87896896 TCCATGGTTTGAAGTAAATAAGG - Intergenic
1193958795 X:87897771-87897793 TTCATGATTTGGAATAAATGAGG - Intergenic
1194138104 X:90173415-90173437 TCCATGATTTGGAGTAAAAAAGG - Intergenic
1194662617 X:96643413-96643435 GCCAATGTTTGGTATAAAAGAGG - Intergenic
1195558715 X:106258092-106258114 TCCATGGTTTGGAGTAAAAGAGG - Intergenic
1198498523 X:137218788-137218810 TCCATGATTTAGAAAAAAAGAGG + Intergenic
1199105799 X:143866128-143866150 TCCATTGTTTGGAGTAAATGAGG + Intergenic
1199130664 X:144182479-144182501 TCCATTGTTTGGAATTAATGTGG - Intergenic
1199233466 X:145466102-145466124 TCCGTGGTTTGGAATAAAAGAGG - Intergenic
1200483899 Y:3743669-3743691 TCCATGATTTGGAGTAAAAAAGG - Intergenic