ID: 993250040 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:85510081-85510103 |
| Sequence | CCTAATACCAAAATCAGGAA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2696 | |||
| Summary | {0: 34, 1: 504, 2: 695, 3: 566, 4: 897} |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 993250040_993250047 | 11 | Left | 993250040 | 5:85510081-85510103 | CCTTTCCTGATTTTGGTATTAGG | 0: 34 1: 504 2: 695 3: 566 4: 897 |
||
| Right | 993250047 | 5:85510115-85510137 | TTCATAGAATGAATTAGGGAGGG | 0: 178 1: 266 2: 216 3: 255 4: 491 |
||||
| 993250040_993250046 | 10 | Left | 993250040 | 5:85510081-85510103 | CCTTTCCTGATTTTGGTATTAGG | 0: 34 1: 504 2: 695 3: 566 4: 897 |
||
| Right | 993250046 | 5:85510114-85510136 | TTTCATAGAATGAATTAGGGAGG | 0: 17 1: 257 2: 929 3: 2287 4: 11048 |
||||
| 993250040_993250045 | 7 | Left | 993250040 | 5:85510081-85510103 | CCTTTCCTGATTTTGGTATTAGG | 0: 34 1: 504 2: 695 3: 566 4: 897 |
||
| Right | 993250045 | 5:85510111-85510133 | TGTTTTCATAGAATGAATTAGGG | No data | ||||
| 993250040_993250044 | 6 | Left | 993250040 | 5:85510081-85510103 | CCTTTCCTGATTTTGGTATTAGG | 0: 34 1: 504 2: 695 3: 566 4: 897 |
||
| Right | 993250044 | 5:85510110-85510132 | CTGTTTTCATAGAATGAATTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 993250040 | Original CRISPR | CCTAATACCAAAATCAGGAA AGG (reversed) | Intergenic | ||
| Too many off-targets to display for this crispr | |||||