ID: 993250040

View in Genome Browser
Species Human (GRCh38)
Location 5:85510081-85510103
Sequence CCTAATACCAAAATCAGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2696
Summary {0: 34, 1: 504, 2: 695, 3: 566, 4: 897}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993250040_993250047 11 Left 993250040 5:85510081-85510103 CCTTTCCTGATTTTGGTATTAGG 0: 34
1: 504
2: 695
3: 566
4: 897
Right 993250047 5:85510115-85510137 TTCATAGAATGAATTAGGGAGGG 0: 178
1: 266
2: 216
3: 255
4: 491
993250040_993250046 10 Left 993250040 5:85510081-85510103 CCTTTCCTGATTTTGGTATTAGG 0: 34
1: 504
2: 695
3: 566
4: 897
Right 993250046 5:85510114-85510136 TTTCATAGAATGAATTAGGGAGG 0: 17
1: 257
2: 929
3: 2287
4: 11048
993250040_993250045 7 Left 993250040 5:85510081-85510103 CCTTTCCTGATTTTGGTATTAGG 0: 34
1: 504
2: 695
3: 566
4: 897
Right 993250045 5:85510111-85510133 TGTTTTCATAGAATGAATTAGGG No data
993250040_993250044 6 Left 993250040 5:85510081-85510103 CCTTTCCTGATTTTGGTATTAGG 0: 34
1: 504
2: 695
3: 566
4: 897
Right 993250044 5:85510110-85510132 CTGTTTTCATAGAATGAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993250040 Original CRISPR CCTAATACCAAAATCAGGAA AGG (reversed) Intergenic
Too many off-targets to display for this crispr