ID: 993250043

View in Genome Browser
Species Human (GRCh38)
Location 5:85510086-85510108
Sequence AACACCCTAATACCAAAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993250043_993250044 1 Left 993250043 5:85510086-85510108 CCTGATTTTGGTATTAGGGTGTT No data
Right 993250044 5:85510110-85510132 CTGTTTTCATAGAATGAATTAGG No data
993250043_993250045 2 Left 993250043 5:85510086-85510108 CCTGATTTTGGTATTAGGGTGTT No data
Right 993250045 5:85510111-85510133 TGTTTTCATAGAATGAATTAGGG No data
993250043_993250048 29 Left 993250043 5:85510086-85510108 CCTGATTTTGGTATTAGGGTGTT No data
Right 993250048 5:85510138-85510160 TTCCTACTTTCTCTAACTTGTGG No data
993250043_993250046 5 Left 993250043 5:85510086-85510108 CCTGATTTTGGTATTAGGGTGTT No data
Right 993250046 5:85510114-85510136 TTTCATAGAATGAATTAGGGAGG 0: 17
1: 257
2: 929
3: 2287
4: 11048
993250043_993250047 6 Left 993250043 5:85510086-85510108 CCTGATTTTGGTATTAGGGTGTT No data
Right 993250047 5:85510115-85510137 TTCATAGAATGAATTAGGGAGGG 0: 178
1: 266
2: 216
3: 255
4: 491

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993250043 Original CRISPR AACACCCTAATACCAAAATC AGG (reversed) Intergenic
No off target data available for this crispr