ID: 993250044

View in Genome Browser
Species Human (GRCh38)
Location 5:85510110-85510132
Sequence CTGTTTTCATAGAATGAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993250043_993250044 1 Left 993250043 5:85510086-85510108 CCTGATTTTGGTATTAGGGTGTT No data
Right 993250044 5:85510110-85510132 CTGTTTTCATAGAATGAATTAGG No data
993250040_993250044 6 Left 993250040 5:85510081-85510103 CCTTTCCTGATTTTGGTATTAGG 0: 34
1: 504
2: 695
3: 566
4: 897
Right 993250044 5:85510110-85510132 CTGTTTTCATAGAATGAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993250044 Original CRISPR CTGTTTTCATAGAATGAATT AGG Intergenic
No off target data available for this crispr