ID: 993250086

View in Genome Browser
Species Human (GRCh38)
Location 5:85510732-85510754
Sequence TCTTTTTGATGTAGTCATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993250083_993250086 25 Left 993250083 5:85510684-85510706 CCAGTTCCTTGAGGTGTGATCTT No data
Right 993250086 5:85510732-85510754 TCTTTTTGATGTAGTCATGTAGG No data
993250084_993250086 19 Left 993250084 5:85510690-85510712 CCTTGAGGTGTGATCTTAGAACG No data
Right 993250086 5:85510732-85510754 TCTTTTTGATGTAGTCATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993250086 Original CRISPR TCTTTTTGATGTAGTCATGT AGG Intergenic