ID: 993250086 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:85510732-85510754 |
Sequence | TCTTTTTGATGTAGTCATGT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
993250083_993250086 | 25 | Left | 993250083 | 5:85510684-85510706 | CCAGTTCCTTGAGGTGTGATCTT | No data | ||
Right | 993250086 | 5:85510732-85510754 | TCTTTTTGATGTAGTCATGTAGG | No data | ||||
993250084_993250086 | 19 | Left | 993250084 | 5:85510690-85510712 | CCTTGAGGTGTGATCTTAGAACG | No data | ||
Right | 993250086 | 5:85510732-85510754 | TCTTTTTGATGTAGTCATGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
993250086 | Original CRISPR | TCTTTTTGATGTAGTCATGT AGG | Intergenic | ||