ID: 993250302

View in Genome Browser
Species Human (GRCh38)
Location 5:85513109-85513131
Sequence GAGCATCAGCTGAAGTAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993250299_993250302 -1 Left 993250299 5:85513087-85513109 CCAGGAAGTGGCACTTCCCAGAG No data
Right 993250302 5:85513109-85513131 GAGCATCAGCTGAAGTAGTGTGG No data
993250298_993250302 3 Left 993250298 5:85513083-85513105 CCTGCCAGGAAGTGGCACTTCCC No data
Right 993250302 5:85513109-85513131 GAGCATCAGCTGAAGTAGTGTGG No data
993250294_993250302 20 Left 993250294 5:85513066-85513088 CCTGTGCTTGTTGGCCTCCTGCC No data
Right 993250302 5:85513109-85513131 GAGCATCAGCTGAAGTAGTGTGG No data
993250297_993250302 6 Left 993250297 5:85513080-85513102 CCTCCTGCCAGGAAGTGGCACTT No data
Right 993250302 5:85513109-85513131 GAGCATCAGCTGAAGTAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993250302 Original CRISPR GAGCATCAGCTGAAGTAGTG TGG Intergenic
No off target data available for this crispr