ID: 993254206

View in Genome Browser
Species Human (GRCh38)
Location 5:85566644-85566666
Sequence ATTCAGACCTAAAAATATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993254203_993254206 -10 Left 993254203 5:85566631-85566653 CCACTGCACAACCATTCAGACCT No data
Right 993254206 5:85566644-85566666 ATTCAGACCTAAAAATATAAGGG No data
993254202_993254206 3 Left 993254202 5:85566618-85566640 CCTTGTCTACTCTCCACTGCACA No data
Right 993254206 5:85566644-85566666 ATTCAGACCTAAAAATATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993254206 Original CRISPR ATTCAGACCTAAAAATATAA GGG Intergenic
No off target data available for this crispr