ID: 993257460

View in Genome Browser
Species Human (GRCh38)
Location 5:85610713-85610735
Sequence GTCTTTTGGACTCCAAACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993257460_993257465 11 Left 993257460 5:85610713-85610735 CCTCAGTTTGGAGTCCAAAAGAC No data
Right 993257465 5:85610747-85610769 GAAATTCCCTCTTGGGAATTTGG No data
993257460_993257464 4 Left 993257460 5:85610713-85610735 CCTCAGTTTGGAGTCCAAAAGAC No data
Right 993257464 5:85610740-85610762 CTCATGAGAAATTCCCTCTTGGG No data
993257460_993257463 3 Left 993257460 5:85610713-85610735 CCTCAGTTTGGAGTCCAAAAGAC No data
Right 993257463 5:85610739-85610761 CCTCATGAGAAATTCCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993257460 Original CRISPR GTCTTTTGGACTCCAAACTG AGG (reversed) Intergenic