ID: 993257460 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:85610713-85610735 |
| Sequence | GTCTTTTGGACTCCAAACTG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 993257460_993257465 | 11 | Left | 993257460 | 5:85610713-85610735 | CCTCAGTTTGGAGTCCAAAAGAC | No data | ||
| Right | 993257465 | 5:85610747-85610769 | GAAATTCCCTCTTGGGAATTTGG | No data | ||||
| 993257460_993257464 | 4 | Left | 993257460 | 5:85610713-85610735 | CCTCAGTTTGGAGTCCAAAAGAC | No data | ||
| Right | 993257464 | 5:85610740-85610762 | CTCATGAGAAATTCCCTCTTGGG | No data | ||||
| 993257460_993257463 | 3 | Left | 993257460 | 5:85610713-85610735 | CCTCAGTTTGGAGTCCAAAAGAC | No data | ||
| Right | 993257463 | 5:85610739-85610761 | CCTCATGAGAAATTCCCTCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 993257460 | Original CRISPR | GTCTTTTGGACTCCAAACTG AGG (reversed) | Intergenic | ||