ID: 993257463

View in Genome Browser
Species Human (GRCh38)
Location 5:85610739-85610761
Sequence CCTCATGAGAAATTCCCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993257458_993257463 15 Left 993257458 5:85610701-85610723 CCAAAAGACTAGCCTCAGTTTGG No data
Right 993257463 5:85610739-85610761 CCTCATGAGAAATTCCCTCTTGG No data
993257460_993257463 3 Left 993257460 5:85610713-85610735 CCTCAGTTTGGAGTCCAAAAGAC No data
Right 993257463 5:85610739-85610761 CCTCATGAGAAATTCCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993257463 Original CRISPR CCTCATGAGAAATTCCCTCT TGG Intergenic