ID: 993257464

View in Genome Browser
Species Human (GRCh38)
Location 5:85610740-85610762
Sequence CTCATGAGAAATTCCCTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993257458_993257464 16 Left 993257458 5:85610701-85610723 CCAAAAGACTAGCCTCAGTTTGG No data
Right 993257464 5:85610740-85610762 CTCATGAGAAATTCCCTCTTGGG No data
993257460_993257464 4 Left 993257460 5:85610713-85610735 CCTCAGTTTGGAGTCCAAAAGAC No data
Right 993257464 5:85610740-85610762 CTCATGAGAAATTCCCTCTTGGG No data
993257461_993257464 -10 Left 993257461 5:85610727-85610749 CCAAAAGACTAGCCTCATGAGAA No data
Right 993257464 5:85610740-85610762 CTCATGAGAAATTCCCTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993257464 Original CRISPR CTCATGAGAAATTCCCTCTT GGG Intergenic