ID: 993261121

View in Genome Browser
Species Human (GRCh38)
Location 5:85659216-85659238
Sequence AACACTCCATGCTCTTGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993261121_993261126 20 Left 993261121 5:85659216-85659238 CCTACCCAAGAGCATGGAGTGTT No data
Right 993261126 5:85659259-85659281 TCTTTTATTTCCTTGAGCAGTGG 0: 3725
1: 8072
2: 4776
3: 2100
4: 1426

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993261121 Original CRISPR AACACTCCATGCTCTTGGGT AGG (reversed) Intergenic
No off target data available for this crispr