ID: 993261122

View in Genome Browser
Species Human (GRCh38)
Location 5:85659220-85659242
Sequence GAAGAACACTCCATGCTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993261122_993261126 16 Left 993261122 5:85659220-85659242 CCCAAGAGCATGGAGTGTTCTTC No data
Right 993261126 5:85659259-85659281 TCTTTTATTTCCTTGAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993261122 Original CRISPR GAAGAACACTCCATGCTCTT GGG (reversed) Intergenic