ID: 993261123

View in Genome Browser
Species Human (GRCh38)
Location 5:85659221-85659243
Sequence GGAAGAACACTCCATGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993261123_993261126 15 Left 993261123 5:85659221-85659243 CCAAGAGCATGGAGTGTTCTTCC No data
Right 993261126 5:85659259-85659281 TCTTTTATTTCCTTGAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993261123 Original CRISPR GGAAGAACACTCCATGCTCT TGG (reversed) Intergenic