ID: 993261124

View in Genome Browser
Species Human (GRCh38)
Location 5:85659242-85659264
Sequence AAAAGAGGATACAAACAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993261124_993261128 16 Left 993261124 5:85659242-85659264 CCAAGTTGTTTGTATCCTCTTTT No data
Right 993261128 5:85659281-85659303 GTTTGTAGTTCTCCTTGAAGAGG No data
993261124_993261126 -6 Left 993261124 5:85659242-85659264 CCAAGTTGTTTGTATCCTCTTTT No data
Right 993261126 5:85659259-85659281 TCTTTTATTTCCTTGAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993261124 Original CRISPR AAAAGAGGATACAAACAACT TGG (reversed) Intergenic