ID: 993261126

View in Genome Browser
Species Human (GRCh38)
Location 5:85659259-85659281
Sequence TCTTTTATTTCCTTGAGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993261124_993261126 -6 Left 993261124 5:85659242-85659264 CCAAGTTGTTTGTATCCTCTTTT No data
Right 993261126 5:85659259-85659281 TCTTTTATTTCCTTGAGCAGTGG No data
993261121_993261126 20 Left 993261121 5:85659216-85659238 CCTACCCAAGAGCATGGAGTGTT No data
Right 993261126 5:85659259-85659281 TCTTTTATTTCCTTGAGCAGTGG No data
993261122_993261126 16 Left 993261122 5:85659220-85659242 CCCAAGAGCATGGAGTGTTCTTC No data
Right 993261126 5:85659259-85659281 TCTTTTATTTCCTTGAGCAGTGG No data
993261123_993261126 15 Left 993261123 5:85659221-85659243 CCAAGAGCATGGAGTGTTCTTCC No data
Right 993261126 5:85659259-85659281 TCTTTTATTTCCTTGAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993261126 Original CRISPR TCTTTTATTTCCTTGAGCAG TGG Intergenic