ID: 993263002

View in Genome Browser
Species Human (GRCh38)
Location 5:85684784-85684806
Sequence AGATTAGCTGCCACTCTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993263002_993263006 -4 Left 993263002 5:85684784-85684806 CCATTTAGAGTGGCAGCTAATCT No data
Right 993263006 5:85684803-85684825 ATCTTGAGGCAGTGGGACAATGG No data
993263002_993263007 27 Left 993263002 5:85684784-85684806 CCATTTAGAGTGGCAGCTAATCT No data
Right 993263007 5:85684834-85684856 CTGCAAAATCAACAAGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993263002 Original CRISPR AGATTAGCTGCCACTCTAAA TGG (reversed) Intergenic
No off target data available for this crispr