ID: 993263135

View in Genome Browser
Species Human (GRCh38)
Location 5:85687307-85687329
Sequence ACATTCTAGGAGGATATAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993263135_993263138 16 Left 993263135 5:85687307-85687329 CCTTCTATATCCTCCTAGAATGT No data
Right 993263138 5:85687346-85687368 TCCACATTCATAAAAGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993263135 Original CRISPR ACATTCTAGGAGGATATAGA AGG (reversed) Intergenic
No off target data available for this crispr