ID: 993266087

View in Genome Browser
Species Human (GRCh38)
Location 5:85728168-85728190
Sequence ATCACAGATGTCCTCATAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993266087_993266089 7 Left 993266087 5:85728168-85728190 CCCTTTATGAGGACATCTGTGAT No data
Right 993266089 5:85728198-85728220 TGAACCCGCATGAATAATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993266087 Original CRISPR ATCACAGATGTCCTCATAAA GGG (reversed) Intergenic
No off target data available for this crispr