ID: 993266471

View in Genome Browser
Species Human (GRCh38)
Location 5:85732338-85732360
Sequence CAGTGTAAACAAAAGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993266462_993266471 16 Left 993266462 5:85732299-85732321 CCACAATTGCTGAGGCTTGAATA No data
Right 993266471 5:85732338-85732360 CAGTGTAAACAAAAGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993266471 Original CRISPR CAGTGTAAACAAAAGGGGCA GGG Intergenic
No off target data available for this crispr