ID: 993267489

View in Genome Browser
Species Human (GRCh38)
Location 5:85744625-85744647
Sequence CCTTCCTTGAAGCAGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993267486_993267489 15 Left 993267486 5:85744587-85744609 CCAAGATACAAGACAAAGTACTC No data
Right 993267489 5:85744625-85744647 CCTTCCTTGAAGCAGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993267489 Original CRISPR CCTTCCTTGAAGCAGAAGGA AGG Intergenic
No off target data available for this crispr