ID: 993275399

View in Genome Browser
Species Human (GRCh38)
Location 5:85850501-85850523
Sequence CTGTGGTTATGCAGGGCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993275389_993275399 14 Left 993275389 5:85850464-85850486 CCAAAGCTGGGGCAGCTGGAATG No data
Right 993275399 5:85850501-85850523 CTGTGGTTATGCAGGGCAGGGGG No data
993275387_993275399 20 Left 993275387 5:85850458-85850480 CCAAGGCCAAAGCTGGGGCAGCT No data
Right 993275399 5:85850501-85850523 CTGTGGTTATGCAGGGCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993275399 Original CRISPR CTGTGGTTATGCAGGGCAGG GGG Intergenic
No off target data available for this crispr