ID: 993277214

View in Genome Browser
Species Human (GRCh38)
Location 5:85875783-85875805
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993277214_993277217 -10 Left 993277214 5:85875783-85875805 CCCAAACAAAGAGTAGGAACTAG No data
Right 993277217 5:85875796-85875818 TAGGAACTAGGAGAAAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993277214 Original CRISPR CTAGTTCCTACTCTTTGTTT GGG (reversed) Intergenic
No off target data available for this crispr