ID: 993279264

View in Genome Browser
Species Human (GRCh38)
Location 5:85904750-85904772
Sequence AGGGAAAGTGCAGTGACTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993279256_993279264 22 Left 993279256 5:85904705-85904727 CCCTGGCAGTGGCTGAGCAGTGT No data
Right 993279264 5:85904750-85904772 AGGGAAAGTGCAGTGACTGAGGG No data
993279255_993279264 23 Left 993279255 5:85904704-85904726 CCCCTGGCAGTGGCTGAGCAGTG No data
Right 993279264 5:85904750-85904772 AGGGAAAGTGCAGTGACTGAGGG No data
993279257_993279264 21 Left 993279257 5:85904706-85904728 CCTGGCAGTGGCTGAGCAGTGTG No data
Right 993279264 5:85904750-85904772 AGGGAAAGTGCAGTGACTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993279264 Original CRISPR AGGGAAAGTGCAGTGACTGA GGG Intergenic
No off target data available for this crispr