ID: 993279314

View in Genome Browser
Species Human (GRCh38)
Location 5:85905112-85905134
Sequence TGCTGTGAGTTGCACTGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993279314_993279315 7 Left 993279314 5:85905112-85905134 CCTTGGCAGTGCAACTCACAGCA No data
Right 993279315 5:85905142-85905164 TGTCTCCTTCCTTCTGCTTAAGG 0: 6
1: 23
2: 68
3: 140
4: 579
993279314_993279317 12 Left 993279314 5:85905112-85905134 CCTTGGCAGTGCAACTCACAGCA No data
Right 993279317 5:85905147-85905169 CCTTCCTTCTGCTTAAGGAGAGG 0: 21
1: 137
2: 245
3: 338
4: 573

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993279314 Original CRISPR TGCTGTGAGTTGCACTGCCA AGG (reversed) Intergenic
No off target data available for this crispr