ID: 993282095

View in Genome Browser
Species Human (GRCh38)
Location 5:85938211-85938233
Sequence TCACACCAATGCTGTCATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993282093_993282095 7 Left 993282093 5:85938181-85938203 CCAGTGGATTTTAAGCATCCTCT No data
Right 993282095 5:85938211-85938233 TCACACCAATGCTGTCATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993282095 Original CRISPR TCACACCAATGCTGTCATGA TGG Intergenic