ID: 993287454

View in Genome Browser
Species Human (GRCh38)
Location 5:86017133-86017155
Sequence ATGGAGAGTACAGTGACTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993287454_993287459 27 Left 993287454 5:86017133-86017155 CCTCCAGTCACTGTACTCTCCAT No data
Right 993287459 5:86017183-86017205 TGCTGCACAGCTGCTGCCAGGGG No data
993287454_993287457 25 Left 993287454 5:86017133-86017155 CCTCCAGTCACTGTACTCTCCAT No data
Right 993287457 5:86017181-86017203 CATGCTGCACAGCTGCTGCCAGG No data
993287454_993287458 26 Left 993287454 5:86017133-86017155 CCTCCAGTCACTGTACTCTCCAT No data
Right 993287458 5:86017182-86017204 ATGCTGCACAGCTGCTGCCAGGG No data
993287454_993287460 28 Left 993287454 5:86017133-86017155 CCTCCAGTCACTGTACTCTCCAT No data
Right 993287460 5:86017184-86017206 GCTGCACAGCTGCTGCCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993287454 Original CRISPR ATGGAGAGTACAGTGACTGG AGG (reversed) Intergenic
No off target data available for this crispr