ID: 993296174

View in Genome Browser
Species Human (GRCh38)
Location 5:86144089-86144111
Sequence ATGTATCAACAGCCTCTCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993296174_993296181 13 Left 993296174 5:86144089-86144111 CCCGGGAGAGGCTGTTGATACAT No data
Right 993296181 5:86144125-86144147 CATCTGGCTGGAGCCCAGGCAGG No data
993296174_993296180 9 Left 993296174 5:86144089-86144111 CCCGGGAGAGGCTGTTGATACAT No data
Right 993296180 5:86144121-86144143 TTGACATCTGGCTGGAGCCCAGG No data
993296174_993296177 -3 Left 993296174 5:86144089-86144111 CCCGGGAGAGGCTGTTGATACAT No data
Right 993296177 5:86144109-86144131 CATGGAACCTACTTGACATCTGG No data
993296174_993296178 1 Left 993296174 5:86144089-86144111 CCCGGGAGAGGCTGTTGATACAT No data
Right 993296178 5:86144113-86144135 GAACCTACTTGACATCTGGCTGG No data
993296174_993296183 18 Left 993296174 5:86144089-86144111 CCCGGGAGAGGCTGTTGATACAT No data
Right 993296183 5:86144130-86144152 GGCTGGAGCCCAGGCAGGGCTGG No data
993296174_993296182 14 Left 993296174 5:86144089-86144111 CCCGGGAGAGGCTGTTGATACAT No data
Right 993296182 5:86144126-86144148 ATCTGGCTGGAGCCCAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993296174 Original CRISPR ATGTATCAACAGCCTCTCCC GGG (reversed) Intergenic
No off target data available for this crispr